The small RNA sequenced data of three silkworm tissues (hemolymph, anterior-middle silk gland and posterior silk gland) were used as queries to search against mulberry predicted microRNAs and five predicted mulberry miRNAs existed in the silkworm.
| Tissue | 1st sequencing | 2nd sequencing | Name | Sequence | Ref miRNA | ||
|---|---|---|---|---|---|---|---|
| Serial number | Reads | Serial number | Reads | ||||
| hemolymph | t0016771 | 5 | t0014885 | 3 | MIR166f | UCUCGGACCAGGCUUCAUUCC | bdi-miR166f |
| hemolymph | t0055412 | 2 | t0005325 | 11 | MIR166i | UCGGACCAGGCUUCAUUCCCC | ptc-miR166i |
| anterior-middle silk gland | t0088756 | 6 | - | - | MIR156a | UGACAGAAGAGAGUGAGCAC | ath-miR156a |
| anterior-middle silk gland | t0102487 | 5 | - | - | MIR157a | UUGACAGAAGAUAGAGAGCAC | ath-miR157a |
| posterior silk gland | t0093024 | 4 | - | - | MIR157a | UUGACAGAAGAUAGAGAGCAC | ath-miR157a |