Family:DTT

Class:DNA transposons

Order:TIR

Superfamily:TcMar

>DTT_1_1_Mno

ACCTCTATAAANTAATATTGTTGGGACTAAAAAAAATATTATTTTAANGAGATTATTATTTATCGATAAATGAATAATTT
ATTAATTTATCGATAAATGAATAATTTATTAATTTAAGAAGAGTTTTATATTTTAATAACTTTCGTACATGTACTTTTTC
TTTTACCAAGATTCATGTATGAGTTATAAATAAAAAAAATAGTGGTATGTAGTCAAAAATTAATATGTTTACATATAGAA
TTTCAAAAGTTATCATGTCATATAATAAAAGTTATATATATGCAGTACATAGAAGCCTAAAATTAATGTAAGTACATTGT
ACATAGAATGTTAATAAGTACATATAGACATAAAATTGATCATGATTCAGATGACAATTGTATTTTATCGAATGTTTCTC
CAAAAGAGGCGTTTCAAGCAATAGTAACCTTAAATAACTACTTGCTACAACATGAAAAAAATATACCAGATGTNGTGCAT
GCTTTGTAAAAAATTAAAGACGAGGTTGAGTTCAATTTAGGTACAAAGAAAAAACAAATGACTTTAGATGCATATTTTGT
AAAAGAGTTGAATTGAGAAAATAGAAGTTGTCAAGAAAAAAACTCTTTAATATNATGAATTNTATATGTTTTTGTTAATT
ATTAATTTATATTTTCGTTGGGCCCTAAAGGATTTGAAAAAAAAATTATTATCTTATGCATTTAGCGAGATTATTAATTT
AGTACATTGGCCCGAGTCGGGACCGAAAGATTTTATTATTTAATCGAGGTTATTAATTTATCGAACATTCATTTATCGAG
ATTTTACTGTA