Family:DTT

Class:DNA transposons

Order:MITE

Superfamily:MITE

>DTT_1N_5_Mno

AGATTTTTACCTCTTACTCTTGATTAATATCTTTTTAGTCAAATAATTATATTAGTCAAAAAGATATTAATCAAGAATAA
AAGGTAAAAATCC