Family:DTM

Class:DNA transposons

Order:TIR

Superfamily:MuLE

>DTM_15_1_Mno

TCCGTAGAAGGATTGATCAGCGATGTAATTTGATTATCATGTGTTTCGCGTACGCAGACATACGAGTGATTGACTTCACT
TAGTGTTTTCCCAATTGGGAAAATTGAACTGAAAAGTATTTAGGGATTTTGACATGGAAAACCAAGTGATTGAGTTTGAT
ATTGGGGTGGGAGGAGGAGGAGGAGATGATGATGGTGTGGACATTGAGCACCACGTTGATGATGAAGAAATGGTTGATAG
CCCTCCTATTGCCTTTGGCGGCGGTTTTGGCGGGAGTGGTGAGATTTACCTTCCGGAGGGAGACCTTTTGGACCTTGAAC
CTTCCGAGGGCATGGAATTCGAATCTGAAGAGGCTGCCAAGGCCTTTTACAATTCGTATGCCCGGCGCGTCGGGTTCAGT
ACCCGTGTCAGCTCTTCTCGTAGGTCTAGGCGCAACGGGGCAATCATACAGAGGCAATTTGTTTGTGCGAAAGAGGGGTT
TCGCAATTTGAATGAGAAGCGCACGAAGGATAGAGAGATCAAGAGGCCGAGAACAATCACCAGAGTCGGATGCAAAGCTT
CATTGTCGGTGAAGATGCAGGATTCTGGGAAATGGGTGGTGTCTGGGTTTGTTAAGGAGCATAATCACGAGTTGGTTCCT
CCGGATCAAGTGCATTGTCTTCGTTCTCATCGGCAAATCTCCGGCCCTGCTAAGACGTTGATTGATACTTTGCAGGCAGC
TGGGATGGGTCCCCGTAGAATTATGTCAGCGCTTATAAAAGAGTATGGTGGAATAAGCAAAGTTGGGTTTACAGAGGTGG
ATTGTAGGAATTACATGAGGAATAATCGCCAGAGGAGCATGGAAGGGGATATTCAGCTCCTCCTGGATTATTTGAGGCAG
ATGCAAGCTGATAACCCTAATTTCTTTTATGCCGTACAGGGTGATGAGGATCAGTCCTCGGGCAATGTATTTTGGGCTGA
TTCAAAGGGACGGATGAACTATAATTACTTTGGTGATACAGTTACTTTTGATACAACCTACAGATCAAACAGATATCGTT
TGCCCTTTGTACCCTTCACTGGGGTAAACCATCATGGGCAGCCTGTGTTGTTTGGTTGTGCTTTCCTAATAAATGAATCT
GAATCATCGTTCATTTGGTTGTTTAAGACATGGCTTATGGCAATGTCCGGTCGCCCTCCGGTGTCAATAACCACAGATCA
TGATGCAGTGATTCGATCGGCCATAGTGCAAGTTTTTCCAGAGACTCGCCATCGTTTCTGCAAATGGCACATCTTCAAGA
AATGTCAAGAGAAGCTATCCCATGTGTTTTTTAAACACCCAACTTTTGAAGCAGACTTTCATAAATGTGTCAACTTGACC
GAGTCAATAGAGGAATTTGAGTCTTGCTGGTCGTCTCTCGTTGATAGATATGATCTCAGGGATCATGAATGGCTTCAACA
AATATATTCTGCCCGAAGGCATTGGGTCCCAGTGTATTTGCGGGACACTTTTTTTGCAGAAATGTCGATAACGCAGCGAA
GTGACAGTATGAACTCATATTTTGATGGATATGTGAATGCTTCAACCAATCTGAGTCAGTTTTTCAAACTTTATGAGAAA
GCTCTGGAGAGTCGGAATGAGAAGGAGGTGAAAGCAGATTATGATACGATGAACACTTCAGCAGCCCTTAAGACCCCATC
TCCAATGGAGAAGCAAGCGTCAGAGCTTTACACTAGAAAGTTGTTTATGAGATTTCAAGAAGAGCTAGTTGGGACGCTAA
CTTTCATGGCGTCAAAGGCCGAGGATGATGGCGATGTCATCACCTATCAAGTATCGAAGTACGGGGAGGATCATAGAGCT
TATTATGTTAAGTTTAATGTTTTGGAGATGAAGGCAACTTGTAGCTGCCAGATGTTTGAGTTTTCAGGTCTTCTTTGCAG
ACATGTTTTAGCAGTCTTTAGAGTCACCAATGTGCTAACTCTCCCTTCACATTACATATTGAAACGGTGGACAAGGAATG
CCAAGAGTAGTGTCATTTTAGAAGAACATTCTAGCAATTTGTATAATAATTACCTGGAGTCTCATACTGTTCGGTATAAT
ACCCTGCGCCACAAGGCCTTTAAACATGTGGATGAAGGAGCAAAGTCTCAAGAAACTTTTGAGGCTGCGCTATGTACTCT
TCAAGAGGCTGCAGAAAGGGTTGCCGATGCAATAAAGAATAATGGGAAAACTGCCATGGTGAATGGGCGTGCCAGGGGAA
ATCGAAACTCCACTGTTAACGCATCTCGGGCTAGCCATTCTGGTAGGGATCATCAAAGGGACTCTGGTCAACATATGTCT
GAGGTAAGAGTCATTTTCACCGTGTTTTCTGTTAATTTATTTTTTCTTTTCGTAGACCTGAGAGTTTCATGTGGTCTGGA
TTTTCCATCTATACTTTTAAATCTTAATTCTTCAACGAGGGTTCTGTTTCTTACCCCTTATGTTGTGTTTGCAATTGCTC
CAAATAATTATCACATTTGTTTATTTGAATTATTATGCAGGATGATATGGACAAAAGGATTCGAGA