Family:DTH

Class:DNA transposons

Order:MITE

Superfamily:MITE

>DTH_3N_4_Mno

TTGGTGTCTAACTAATTAAATCATACCACATCATCTCATGATAAGTACAAAAGAATTAGTTAAAAAACAATTTAAATTTT
TTACATGACGTGACATGATATGATTGATTAGACACTAA