Family:DTH

Class:DNA transposons

Order:TIR

Superfamily:PIF-Harbinger

>DTH_11_1_Mno

AATGGGAATGACATGTATTAGTAATGTTCTAATTAAAGATTCTGAACTTTCATTAGATTTATTATGAATAATGTTTTTGA
TTATTATCCTTAAACACTATCCTCTCGTATATAACACTTATATACTATGTTTAAGGTTACATAAATAATCACGGAATTTT
CATTTGATATTCATAAAATATATGCACATAAAATGATGAATAAACTCTTTTATTAAATAAATAATAAATATCATATTACA
TCTCATGCTTTTAGGACACTATTCCCAACAACAACATGGTATGAACGCACAAGAAGTGGAAACATCCGAAATGGGTGGTC
GGCTACAACGTAATCACATGGTTAATTTTATGGATTATCTAGCTGATCAAATGTGGGATTCGTATATACGACAGTAATAT
AAGCTAAGATTATTCACTAAGTAATTTTTTTTTTTTTACTAATCAATCACTAAGTTATCTTATTTTAAATTATTTACTAT
TTATTTGTAATGTAATTTAAATTATTTTATTAATTATTAGTGTTTTTATTTGGGATTCAATTATTATTTATTTAATATAT
TATTATTTTAAATACTATTACATGTTTTCAAAAATTAAACCACCAAACACAATTTCAGTTTTTTTTTTAAACTGAAATCA
ATCTCTGAATAAAACTACCAAATGCATTTTCAGAAATAATTCCAAAATGAAAATGAAAACATTTTCATTTCCCTTTTCAT
ATAGAAAACAAAATTATTTTTGAATGAGTTCCAAACGCACCCTGTATATCAGTGGTTCTCAAAGGTGTTACAAACTATAT
GCCGTTTGTGTCATGACTTTATAGAGGCCCCCAACTACGATAAAGTTCAGCCGTTCATATCGGACAATGCTCATAAATAT
TGTCCTTGGTTTGACGTAAGTACTCCTTTGCTTGTCTAGTTTGATTTTCTCAATTTTTGCTCCGACTCTTTTATAGTTAT
TCGTAACGTTTGTTTATTATTTATCCTGCGGAATTGTGTAGGGGCAATTGACAGCACTCACATACCATGTGTCCCACCAA
GCGAAAGAGTTGGAATTTGGCGTAACAGAATGGGGTTTTACTCTATGAATATCATGGCAGCATGCTCTTTTGATATGAAG
TTCACATATATCTTATCTAGTTGGGAGGGATCTGCGCATGATGCGCGAGTGCTTCAAAGTGTTGTTTGGGACCCGGCAAA
AGATTTTCCACGTCCACCTGAAGGTTTTTCTCGCAAGCTAGTAATAGTAATGACAAATAATATACAAGTTCAAAACTTAT
CCATCTTATTTATTTTGTCCAGGTAAATTCTACCTAGGCAATTTTGCATATGCAAACAACGATTGTTTCCTGACTCCATA
TCGAAAAACCACTTACCATTTGCAAGATTACAAGGTTCAATGTGATGGTCTTACTTCACAACGGGAGTTGTTTAACTACA
CACACTCCTTATTGAGAAATTGTATTGAGAAGACTTTCAAAATATGGAAGGCAAGGTTCCCTATACTAAAACGAGCAAAT
AGTTATCCAATAGAGAAGCAAGTGAGGGATTCCGGTGGCATGCGCAGTCTTGCACAATTTCGTCCTTACGGTTAACGAAA
GGGATGAGCTTTTGCAGCGATACTTTCGCGATGGAGTGCCGGATTCAGATATGGACCTTGAGAATGCATATCCTATCAAT
TATGACGTCGGTGCAAATAATGTTTTTCCTCATGGTCCCGCTGTGTGTCGCAACAGAGCTGACCGCGTAGACATGAATCG
ATTCAGGGATCACTTGGCAGACCAAATGTGGGCAGCCTACACACACCCCGCTCGTGATATAGGTAGCACTTACATTTGTA
TACGGAACTTTAAGGCAAGATATATGTACATATATATTTTTTTGAGTTGTACTTGAATTCTAGTATGGACAGAACTATAA
ACGTACCCTTTTGTGGATTTCAAAACTATATGGGTGGAAAACGAAATGGTTGCAACGAAGTTAAACTCGCCTTCATAATT
CAACTCTTCCTAGTTCCTATTATAATTTGATTTGTTTGGTTATTTTTCTTCCCTTTTTTTTTCTTCTTTTCCTATGATCT
TTCCTTTTTAACTTTTAGTGATTTTACAATGATAATTTTTACACATTCTTATAAACGTACCCAAAAAAGTCTTTTCTATT
ATGCTTTTGATAAAGATAAAATTTTTTATACGTTTTTATATATTTATAATTTTAACACTCTTCTACTCCTTGACAGTTGA
CACAGCGGCAACGACAAAGCTGTCGCCTCCCCAAAATATTTCCCCTATATCCCATAGATCTCTCAGATCTTCAAGCTTTT
TTTTTTTGGAAAGGAATTCAGCAAAATCTCATCAAGTTAAAGAATATATCACATCCACATTTCTCGTTGAAAAATTGGCA
ATGCAAAATAAATCAAACTCCACAAACATGAATTCTATGAAACTAGTGTTTCTCGAACTCTCCCTTTTTCATTCATCTCT
TTATTATTATTATTATTATTATCTGGTGAAA