Family:DTC

Class:DNA transposons

Order:TIR

Superfamily:CMC

>DTC_14_1_Mno

CACTAAAACATCTTTCCAAAATTTGCTAACGCTTTGTTCTATTCACTAATTTAGGGCCCGTTCACTTCGCTGATTCGAGT
TTAGAATTTAAGTTGAAATGTGACTTTATGTGAAAACTTTTTACTGTAGTAAAAAAATTAGATGTGATTGTTTGTGAGAG
CTTTTTACTGTAAAAAAACTCAAATCAGCGAAATGAACAGATCTTTAAACTGTAATAAAATTAAAATTAAAAATTTAAAT
CAATAAAATGAACGATGTTTAAATCTCGTATTCTCTTCACTCTCTTATTATACGTCATATATGTCCTCCGTAGCATTTAA
CCTAATTTGGGCAGAAGAAATTAGGGATTCTTTTGTAATCGGGGATTTGGGATTTTCTCCATCACTACCACCTTCGTTCA
TTCGCCACTGTCACTTTACATCCCGTTGTCGTCAGCATTGGTGCCTTTGCTGTCATTGCTCACTTCAATCTGCTACCTCC
ACTTGAAAACCAACCGGCCGCTCGTGACTATCCCCAACCAAAAAGCTTCGAAATCCAATGAAAAACTTTGACGTAGGTAA
GCTTTGTATAGCTCTCCGATCGACTTTAATAGGTAAGCTTTAAACTCCTAGGCCAGGGTAAATTTTAATTTTTCTCATTT
TTTTGTTTTTGATGGGAAAACGTATTTCCTATTTATCTATTTCAATCATTACAAGAGCAAGAGCATATATATAGGAACCC
TAGCCAACAAAAAATAGAAAATAATCCCGGATTTGTGTTGAGAAATCTTCAATCGAATCAAGAAATAAATTACAAGAAAA
AAGAATGGGGTAGTAGATTACCCAAATCCTCTAAATAAGGAAACTAGTGAAGTTGTAATATTATAGTTGTAAATTCTTTA
GTCAACACTATAATTCCAACTCTCCCTCAAGTTGGGCCGTAGATATTGATCACACACAATTTGAAACTCAAGTCCTTAAA
GCTAGTTCTTGGCAAAGCCTTGGTAAGAATATCCGTTGTTTGAAGTCCTGTTGGAGTGTACATGAGAGTGATAGTTCCTT
CCTCTATTTTTTCTTTGATGAAGTGACGATCTATCTCCACATGTTTAGTCCTTTTATGATGGACCAGATTTTTGGCAATG
CTTATGGCAGCTTGATTATCACAGAACATTTTCATAGGAGTTTCAATTGGAATTTTCAACTCCCCAAGTAACCATTTCAG
CCACATTCCTTCAATAATTCCATGGGTCATAACTCTAAAATCTAACACTACACAACTCCTAGCCACTACGGATTGTTTCT
TGCTTCTCCGGGTAACTAGATTCCCCCACACATAGGTACAATATTGTCACGCCCCCAAACAGGGATTGGTGACATGGATG
CTTGTTTAGAAATTAAACACTGATTAAGAAAGTAATTAAGCTAAAGTCAAAGTCAAAGATAATGTATATATAAGAATTTT
CAAACAAACCCTACTATTTTAAGGAAATTGAGTTTTAGAAAAGAGTGAGGCGGACTTTACAAAAACCACAATCAGAGTCA
AATTAATTTCAAAAGTCAGCCTCTGGCATCCACAGGGTTTCCACATTGTGCATACATAAACAATACATAAAAGTAAATTA
CAGACATCAACCACAGTCTAGTAAAGTTTAAAGTTAAAATCCATAATTTATACATGCCTTAATACACGTGGCAATGAGGG
AGGTAAATTATAATTTCTTCACTTCTGGAGATCGGCTCACCTCACCGGCACTCACCACTACTTCTAACGTCGCTTGAGAG
GGGTTTAATACATTTAAAACAGAAGAAAAGTGAGCGAAAGGCCCAGTAAGATATAATTTTATAAAACTGAATAAATAAAT
GAAAATACATGGTCTGAACATGTCATCCAGAACCAAACGTCCATTTTTTGAAAGGAAAATAAACTTAAATTTCCGGTTTC
AGGCATTATCAAGTAATTTATAAGTTAGGATAAATTACTTACAAGCATTGCAAGGCCAAACACCACCGTAGTGAGCCGTA
CGAGTTTCGGGTCCTGCCTCCAAGGATACGATCCCGATCTCTAGGCCATCAGCGTTGTTACCATTTCTTAAAATATCTCA
TTTTAAAAAAATATCATATAAAACTCTTCTTTAGATTTCAATAATTTCAAATACATTTTTATCTTTAAAACGTTTTCATA
GGCCAAACACATTTAAAACAGGCTAACAAGGATGTGGACATCTTACCTCACGGATGTCAATTCTACGGATAACTTCAAGT
AGTCCTAGCCTCACTTGTCTTTGAAGCTTCAAGTCTTATCATGCCGCTAGCTTCAGTTTAGAGTTTAATCATTATCTCTA
AATAATCTAGCTTAATTATGTACAATTGTATCATATTAGTGTGCTTTGACTCAAAATCAAAGTTCATAAACAACTTCTTG
TTGGTTTTCGAATCGAATTCGGATGCGGAAGCGTGAGGATAGCGGATCAAGTATAAAAAGAAATTTCATAAAACATTTGA
GATACTCTATAAATTATATTAATTTATGCACGTATAAATTAATCACATTAATTTATTTATTAAGAACTCAATTAGTAATA
ATACATGGAGGCCGATTAGGATGATAACCTGAGTTCCTTGACCTCGAACAATCCTTGCTCCAAAGCCTTGTGTTTAAAAA
ATCAATGTCTTTCACGTCAATTTTTAGAATCCATGAAGATGTGTGTGTGGGCACACCTGAGACAAAACGGGTTAAAATAA
GCACTCAAATTTTCACAAACACCAACGCATGCACGATGTGGAATTTGACTTACCCTACGGCAGTACTCAAGAGTTAAGTC
TACAGAATCTAAAACAGTGGGTTACACTCATAAAATATAATTACATAGTTAATTATATTTTTAATCAAAATAACGATAAT
TAATATAGATTGAATATATGAGATTTTTTTATAACCTTATTAATTGAGAGAGTCTTGGTCTAAGTTATCTCATTTACTTG
TTTGACAAGTTATCCAATTAAATTTAAAAATAAATTAAAGTCTGACTTTGTTTGAATTTGAATTTAAATAAAAATCGAAA
AAAAAGACAAAAAGAAAAAATTTATCTTTCTTCTACACTATGTAGGGCACCACCCACAAGGGATAAATAACTGTGGGGGC
TGATTTCTATAAGGAGAGAGCAAGACAATTTTGTTTCAAAATTAAATGGGAATTATATTTTTATTAGGATTTAAAATATA
AGTGATAACCAATTTTCTATTGCCATTATAAAAAAATTATGATTTAATGACTCAAGATAGATGATAGTTTTAATAAAACC
GTTATCTACATTTCCATTTAGAGTGCGGACATTTTTATTTGAATATTAGACAAGGGTTTCTTAAGAAACCGTTGTCCAAT
ACTTAAATAAAGACGAAGGTTTATTTTTAACAGTCGTCTAAATGTTCTTTTATCTAACACAGGTCACGCACACTTCTCAT
TTTCCCAAAAAATACACTGAGATATCTCTCTCTCTGTGTGCAACTTGCGAACCCAGAAAATTAGAACGTCGATCAGTTGT
CCTTGCTCGCCCATCAACACGCCGACACATCTTTCGTGGTCCACCTTCACCGTTCACCGTCACTGCCACTCTTCATTCCT
CCAAGCTAGGTACATCTCTCCTAAATCTTGTTTTGTTTGGTTCAGACAATATTTTAAGCATTAATTTGTTGATTTTAGTA
TTACTTTGTAAAATTATGAAATATTTGGTTGGATCACCTTGAAATTAGGTTAGATATGGTTTGGGTTATAGTGAATATTA
TTTGGATTCTATGTTATGATAATGATTGGGGTAATGTAAATTGGTTATGTATTCGGTAATGTGATTGTTGATGTCTCGGA
TTGTGTGGTTGAATTTTAAAATTGTTTGTAAAATTAATTTGGGTAATGTGTGAATGGAATGAGATATGATTTCGCTTGTG
AATTAATTGATAAAATTATTTATTTAAGTAATGTGATTGTGGTTAAAAGTTTAAATTGTTTATTAAATTTATTTAAGTAA
GGTGTGAATTGAATGTGATCATAATTGTATTGTGAAATTATTATTATGAGAATATAATTAAAAATTTTGTGTCTATTATT
TTGGTTTTGTGTAGCAATAGATAGAAAATGGATGTATGCAAATAAGATGAGTGATGAATATAAGAGAAGGGTTGAAGAAT
TTGTGTCATTTGCAAAGAATTCCACGAAAGAGAATATGATTCGTTGCCCGTGTGTGCAATGTGGAAATATTAAGAAATGA
TTAATAGATGATCTTAGATTTCATTTGTTCTAATATGCAATTGATCGAACTTATCAAACATGGATATGGCATGATGAAGA
TGTTCCTACTTCATCATCGGTGGTTAGGGGGAATGATGATGTTTATATGGATCATAAAGAAGATAGTAGTAACATGGTTG
AAATGATGAACGATTTGGAGGAAGAAATTTGTCAACTGGCCATAGTTGTTTGAAAAGATGATGGATGAGACGGAGACACC
GTAGTATAATGGGTGTAAGAAGTATATCAAATTGTCCGGTTTGATTAGATTGTGGATCTTGAAAGCATCGGGTGGGTGGT
TTAATGCAAGTTTCGTGGGACTTTTAGAATTTCTCAACAATACACTCCCGAATAATAATCAAGTGCAGGATAGTATGTAC
GAGGCTAGGAAGACATTGAGCTATGGGGATAGAGTATGAGAAGATACATGTGTGCTCGAATGATTGCATTCTATACCGGA
ATAAGTGTGCAGACTTGGATGAGTGTACGGTGTGCCATGAGTTTAGGTGGAAGAAAGGTAAGAAACCGTCGAACGGAAGA
AAAAGAGTGCCGATGAAGGTGTTATGGTACATTCCAATTGGACCACGTTTAAAGTGATTTTATAAGAATACGGAGCATGC
AAAAAATTTAACTTAGCATCATGATATGAAGTTCGATAATGGCATGCTACGATTTTCGGCCGATTTTCCATAATGGAAGA
CATTTGATCTGGCGTATCCTGAATTTGATGCGGAGCCTAGAAATGTTCGCCTTGCTTTTTCGACCGATGGAATGAATCCT
TATAGTAATTTGAGCAGGAAGCATAAGACATTGATGTCTTCTGCATGAAGAGGAAGTTCGTAATGTTGACCTTATTGATC
TTAGGACTTAATCAACTGGAAAATGACATTGATGTCTACTTGGCACCGTTGATCGACAAGCTAGGGAGCTTGTGGGAAAG
AGGGATCAAAGTTGAGGATGGTTTCCATCAAAAGACCTTCCACTCCATACAATGTTGATGTGGACCATTAATGACTTCCC
TGCATATAGAAGCCTATTTGGGTACTCAGTTAAGAGTTCCATAGGTTGTCCCGTTTGCATGATGGAGACATATTCTATCC
AGTTGGAACACAGAAAGAAGACGGTTTATGATGGTCATAGGAGATTCATGCCTATGAATCATCAATAACGCAAACGAAAA
AAGAATTTAATGGTAAGACTGAAGAAAGACTACCTCCAAAACCGTTGATACGGAAACAAGTATATGAGATGATCAAGACG
TGAAAGTGGTCTTCGGGAAAAAGAAGGAAACAAATAAGGAGCTAGTGATCGGACCTTGGAAGAAGCAGTTAATTTTCTTT
GAGCTTCCATAATAGAGTTCACTGTTCCTTCGTCATTGTTTAGATGTCATACACATTGAGAAGAATGCTTGTAAGTCAAT
AGTTGGCATGCTACTTGACATCCCCAGTAAAACTAAAGACAGCCTCAATGCATGGTTAGATCTCATAGAAGTGAACATTA
GAGGTGACATGGCTCTTGAGAAAATAGGCTCCCACATTTACTTACCTCTAGCTAAATATACACTATAGAGACAAGAGAAG
AAAAGGTTCTGTAAGTGGCTTGCTTCGATCAAAGTTCTAGAATGGTATTCTTCTAACTTTAAGAATTTGGTGTCGGTGAA
GGACTTAAAGATTATTGGAATGAAGATGCATGATTGTCACACATTGATGCAACAGTTGTTGCCATTTGCTTTGCATGGAA
CTCTAACAAAGGAGGTTAGATATACACTTACCAAGTTTTGCTTTTGTCAACTCCATATGCTCAAAGATACTAAATACAAT
GATATTTGATACAATACAATCAAAGTTGGTGAATACCTTGTGCATGCTTGAGAAGTATTTTTCACCATCCTTCTTTGACA
TCGTGATTCATCTAATGGTGCACTTAGTTCGTGAAGAGAGACTTTGCAGACCGGTGTACTTGAGGTGGATGTACCTATTT
GAAAGATACAAAATCCTATAAGATTATGTCAAAAACTAAAATAGGCCAGAGGATTGCATTCTGGAAAGTTATATAGTTGA
AGAAGCTATTGAATTTGACTCGTAGTACTTATCTAACGCAGAAGCAATAGGTTTACCTAAGCAAGTAAACATTGAATCCA
AAAGTAAATTTGCCACTACTCCTTCGTTGGTTCCTCGCGAAGTATGGGAACAAGCTTGTTTCTATGTTCAACACTATACT
CGTGAGTTGAACCATACATCGAGGTGCACAAAAAGAAAATAAAGGCAGCATTCCTAAAAGGAGGAAAAAATGAGAAATTG
TTGCAAAATAAGCATAACTGGACATTTAGAGAGTGGATAAAGACAGACGTTTACTCTAAGGTTTACGAGCCTCAAAATGG
TGGCGTCTCTCAAGTCATGTTAAAGCACTCAATAAATGGCTATACCTTCTACACTTACGAAATAAATGAAAAGCACCCAC
TCTAAAATAGTGTTGTCAATCTTCTTGTCGATGCTATGTATGTTTCCTCTACAAAAGACCAAAATCTTATATATGGAACA
ATGACCTACTATGATTTTATCAAGGACATATGAGAACTTGACTATTGTGGATTGTGAGTGGCACTTTTTAAATGCAATTG
GGTCGACAATAATCATGTGAAGGTTGATAGCGACAGTGCTGCAGTTATAGACATTCATTGACTAGGCTACAAGAATGAAC
CCTTTATTTTGGGAACACAAGCAAAACAAGTTTTCTATACAACCAATCCTAAAGATTTAGAGTTGTCATTGGTTGTTCCT
ATGAAGCCAAGAGCAATTTGTGATGGCGAAGGAGATGATGACGATTGCACCATTGGTTACTAGAGGATTGCCACCGGTTG
ACGAGGTTGATGTTTTTGAAGATGATGATTTCACTTAATTTGTTTGGATGTTGAATAAACATGTGTTGAAAAAGGTAATA
ATAGGAAGAGAAAAAAATGATCATGTATTTATATGTACCTTTATGAACATTTAATTTATGTGTTTGTGAAATTACAATTC
ATTGTGTACTATTGTCTTATTTAGTAATTCATTTCATCATGTTATTTTTTAATTTACTTGTTATTTGGTTCTATTGTAAA
TTTTTATTAATATTTGAAATAACGTACTGAAATTAAAGAATTGTGATGCCAAATAACACACGGGATATAGGCCACCTGTG
GGACAAGCTGTAAAATATGCATGACTTTTTTGATACTGGAACGACATATAACGACGATTTTTAGTAAAAACTGGCATTAG
AAATAAACATTCAACGACGGTTTCTACAAAAAACCGTCGTCTAATACTTTCATGGTACCGTCGAATATCATATTAGACAA
CGACTTATGCATAAAACCGTCGTGTAATGAAATTTTTAACGACAGTTAAAAACCGTCGTAAAAGGTCGTAATGATTCGTC
TAACCATCATCAAATCATATTACGACGGTTACTAACCGTTGTAAATAGTCATATTTCTACTAGTG