Family:DTA

Class:DNA transposons

Order:TIR

Superfamily:hAT

>DTA_33_1_Mno

GTTAGGATTGAACTATTGTTATTGTTTTGTATCTTAGATATTGCGTATTGGTTTTCAATACAAAAAATGATGCTTTATGG
TTTCAAACCTTAAAGAATCTATTTTTGTGAGTCCCTGGTAATTTTTTTCTGTTTTTATTCCTGGTGTAGATACAAACAAA
CAAACAAATAACAAGCCTTAATCCCAACTAATTGGGGTCGGCTATATGGATTTCACTTTTCCACACTGAGTGAAATCCAT
GAGAGTGACTTGCTTTTATTCCTGGTGTAGATATGGAACCAAAATCTATGATGGACATGGCAGTCATTCCGATTGATCAG
GTAGATATTGGATTGGGTTCTTCAGAGAAGCCGAACGTTGTAAGTTCAGTAAAACCAAGAAAAAAGACGATGACATCAGT
CTATCTTAAGTTCTTTGAGACTGCTCCTGATGGAAAAAGTCGCCGCTGCAAATTTTGCGGACAGAGTTATTCTATTGCTA
CTGCAACTGGTAACCTCTCTGCCTATGGTCTATCATTTATATTGATCATACCACTCGCAATAACTTGAAAATTCTAAGCT
TGTGGTGAACGAAAGTCGGTCCCATGTTGTCTAGCTACAGATCTAGTCTTTCATCTGTCATACAGCATATTCACTAATCT
TCTCTATGTGAAGGTAACTTGGGAAGACACCTTAGTAATCGACATCCAGGCTATGATAAGTCAGGGGACACTGTCACTAA
TTCCACGCCACAGCCTGTAGCAGTAACTGTTGCCAAGAAACCTCAGTCACAAGCGAAAACATCTCAAGTGGATTATGATC
ATTTGAATTGGTTGCTCGTTAAGTGGCTTATTGTAGCAGCTTTGCCTCCTTCGACATTGGAAGAAAGATGGCTAGCAAAC
TCCTATAAGTTCTTGAATCCATTGATTCAACTTTGGCCAGGTGACAAGTATAAAGCAGTATTTCACGAAGTATTCAGGAG
CATGCAGGAAGATATAAGGGCATCTTTGGTGCATGTTTCTTCTAGGATCTCCATCACACTTGATTTCTGGACTTCCTATG
AACAGATATATTACATGAGTGTAACATGTCAGTGGATCGACGAAAATTGGTCGTTCCAAAAGGTGTTACTCGATATCTGT
TACGTACCTTATCCTTGTGGGGGTGCTGAGATCTATCACTCCCTAGTAAAGATCCTTAAGATGTATAACATTGAGAATAG
AGTCCTTTCTTGCACTCATGATAACAGTCAAAGTGCCATCCATGCCTGCCATAGTTTGAAAGAGGATTTGGATACTCAAA
AATTGGGGTCCTTCTGTTATATTCCCTGTGCAGCTCGTTCTTTGAATTTGATCATCGAGGATGGGTTAAGAACGATGAAA
CCAATAATCTCTAAGATTCGGGAGTTTGTACTGGGGTTAAATGCATCCCCAGAAATCTCTGAGGATTTTATTCAATTAGC
AGCAGCTTGTCAAGAAGGTAGTTGGAAGTTTCCACTCGATGCTTCAGCACGATGGAGTGGCAACTATCAGATGCTTGATA
TTGTCAAAAAGGTACTTGCTGTCGGGCTCTAAGCACTCTGCTTTGAAATATGCATGTTATACAAGCTTGCTTATATGTGC
ACTATGCATCATTTGACTAAAACACTAGTTTGATATGTACATTACAATAATATCCTCTTTCCTATTGATGTTTTTTACTG
TTGCATGAAAATCGACATCTGGTACACTGCACCCTCGTGAACTCACCCGAATGGCCGAATCCAATAAAATACTAGTATTG
CCTCTTGTTGTCAATCATGCAATTTGTGATATCTATAGCTTACGTATGCATCTTGATTAGTTTTTAATGCATCCAATATT
GAATGTAACATACAGTTCGTTTGCATTACTATTATCTTTTAGGGCGTCTCAAATGACGAAGCTTTGTGTATTACATTATC
TTAATAATTGTTCTACTACTTAGGCTTTGAATTTACCGAGTCTGACTAAATATGGCCTAGGATTTTATTTAGGCCAGCAA
GTCTATGGATGCTGTTATCAGGAAGTATGAGGAGACGCTAGGCAGTAGGATGTTACTGAGCTCTGCTGAAAAAAACGCAA
TCAGTGTTGTCCATGAATATCTGGAACCCTTCTACAAAACCACAAACAATATCTGCACAAACAAGGTGCCCACCATTGGG
TTGGTTCTCTTCTTCATGGATCACATCTCCGAGATGATTGCTGCCTGCAGAGAAGCTCGTCATTATCCAGACTGGCTGAA
GAATGCTGCCGAAGACATGGCCAAAAAGGCCAGGAGTTATAATAACCAGGTCTGCAACATATTCACTTACATGACTGCAA
TTCTGGATCCTCGAATCAAAGGAGAACTAATTCCCGAGAACCTCAGCAATGAGAATTTTCTCGAGGAAGCACGATCCCAT
TTCATAAGAAATTATTCGACTAGCCATTTCCCATCTATGACTAGTGGATATGGCACTCAAGATATTGAAGATGGGGGTAG
TGTCTCGTTCGCAGAGGAAATTGCACGAAAGAAACG