Family:DTA

Class:DNA transposons

Order:MITE

Superfamily:MITE

>DTA_1N_1_Mno

TAGGGCTGTTCATAAACCCGCAAAACCCGCAGGCCCAACCCACCTCACCCCAACCCAACCCGAAAAATGTAATTTTTAGT
ATTAAATTTTTTTTTCGGCCCATTCAATGTCTGGCCCGAAGTTTTGGGGCGGGGTGTGGGTTGGGCCTATAATGGCCCGC
ACACCCCAACCCAACCCGCGCTCTAACTTGCCTCCTCTAATATCTAACCCTAGGCAGGCAACTCATTTCTACTCTCTAGT
TTCTTCATGTTTGAATTAAGCCTCTATGTTTGCTTTATGTTAAGACTAATTTATGAGTGTAGACTAATTTATGTTTGCTT
TATGTTTGATGTTGGATGGACTACTTTGCTTCATGTTTGATGTTGGATTGAACTTTGAATTTCTATCTGTTTGAATGTTG
GAGTTATTATTTCTATTTGATGATGAACTTTGAATGTTGGATTGAACTTTGAGTCTTTGATTCTTTGAATGTTGAAACCG
ACCACCCAACCCACCCCGCACCGCCCCAACCCAACCCAAACATCATTGGGTTGTGAAATTTTTCTAACATCGTTGGGGCC
AAATATGTGCAACCCGCACCCTTTGGGGCGGGAGAAGAAAAAGTCCTACCCCGCACCAACCCAACCCATGAACAGCCCTA