Family:DHH

Class:DNA transposons

Order:Helitron

Superfamily:Helitron

>DHH_12_1_Mno

TCTCTACTACCAATTAATAATAATCCTCTAAAATTTTCACAACCCTATATATATGACACAGAAAATGAAATCCGAAATCG
GATAGCATATTTCTCATTTGATAGTGAATCTAAAAACATAATACAATTTATAGTTAAAAATCTAATCAGAATGCTTGATA
AAACAAATAAATTAGTTAAACTTTTTCGAATGATAAGGGATAGATATCAACAAGATGAGATGCCATTTATAAAACTAAGG
CTTATAAGCCGAAAAAATACATATAGTAACCAATATGACCTACCCACATCGAACGATATAGCTGGTTTAATAGTTGGAGA
TATTGGCGAATATGAACAAGGAAGAGACATTATTATCCAAGATAAAGCATATACTTTACAAAGAATTACCAAATTACACC
CATGTTATATGGCCCTTCAATATCCTTTATTATTTCCATATGGAGAAGATGGTTACACAATAAATTTAAAATATAATATA
AATAACTTAAGTAATAGATATATAAGAAAAAAAATCTTTATGCGAGAATTCTATTCCCATCAATTACAAGAACGTAGAAT
TCAAGGCAATACACTTTTTTGAAGAGGCAGATTATTTCAACAATATGTAGTTGATGCATATGCTTCTGTAGAAGAGGATC
GATTAGATTATATTCAGAAAAATCAAAAAAATTTGCGATCCGAGATTTATCAAGGAATTCAAGACATTATTACAAGAGGA
GATACAAATGCACAAGCAATAGGAAAAAGAACTATCCTTCCTTTAAGCCATACTGGAAGCCCTAGATATATGATCCAAAA
CTATCAAGATGCAATGGAAATTTGCAGACGCTATGGAAACACAGATTTATTCATAACATTTACATGTAATCTAAAATGGC
CTAAAATTACTAGAGCCCTAGCAAAAATACCTAGATAAAAAGCTGAAGATAGACCATATATTATCACTAGAAATTTTTAA
ATGAAATTAGATAATGTTTTATCCATCATTAAAAATGAAAAATATTTAGAATAATTACAGCAGGTTAGATTTCTTCTCCT
AGACTTTTTTTAGTTTCTCGATAAGAAAAAAACACTCCTTTTTTCTAACACTACAAAAAAATTACAATAAAATATTTTTC
AATCTTGCAGATTTATATGTTATTGAGTTTAAAAAACGAGGACTAGCACATTCTCATTTCCTCTTCTGGCTCCACCATGA
TGACATACTACGTGAGCCATCACAAATAGACAGATTTATTTTTGCAGAAATACTTGATCCTCATAATAATCCACTAGAAT
ATAACATTGTAGCTGAATTTATGATGCATGGACCATGTGGCATAGCTAAGCCAAATTCTCCATGTATGAAAAATTCAGAA
TGTTCAAAAAAATTCAACAATGAAACAACCATTGACGAAAATGAATTTCTTAACTATAAACGAAGAAACACATCCTCTTA
TGTCAAAAAAGAAGGTATTAAATTAGACAATAGATATGCAGTTCCCCACAATAAAAATTTATGCTTAAAATTGCATGCTC
ATATCAATATAGAACTTTGTTCACAATCTATGCTTATAAAATATTTATTTAAATATTTAAAAAAAGGACCAGATAGAATA
AGAGCAGTCATAGAAGATAACATACATACAAAAATAACTGGAGAAACTAGTTATCAAGAAATAAATGAAATAAAAAACTA
TATTAATTGCATATACATAACACCATATGAAGCAATGTGGCGACTGTTTGAATTTTTTATACATTATAGAAATTCAGTTG
TTCAAAGACTATCAATACATTTGCCAAGAATGCAAAATATAACATTCCATTCAAATCAATGTCTAAATAACATAATAAGA
CAACTAGGTATTGATAAAACAACTCTCATTGAATGGATGGAAACAAACAAATATGATATTAATGCAAGAGAACTAACTTA
CATAGAATTTTCAATTAGATATGTTTGGAATAGTAAATATAAATATCGGTCTCCAAGACAAATAGGACATACAATTGGAC
AAACTTTTCATGTCCATCCAAGCTCTGGAGAATTATACTATCTTAAATTATTATTAAATCATCAAAAAGGCACAACAAGT
TACGAAGCTCTTCGAACAATTAATGACATAACATATTCAACAAACCAAGCAACATGCTATGCATTAGGCTTATTAGGAGA
CGATCGAGAATGGGATGAATCTATACTAGAAGCTACATTTTGGTCAACAGCAACTCAACTACGACAATTATTCATCATAA
TTTTATTATTTTGCAATGTAAATAACCCAATAAAATTGCTTGAAAAACATTGGAAACTTATGACAAATGATATATTACGC
AAAATTAAAACTTTATTTAATAACTCAAATTTTCAAGTACCTAAAACAGAATTGTACAATTTTGTACTATATGAACTAGA
AAAATTATTAAATTCAAATTCATCAACCTTAACACATTTTAACTTACCTCTTACAACTAGATCATTAATGGATGTTTTAA
ATAATAAACTTTTAAGAGAAAAACTTAATTATGATATATATAAATTAAAAGAAGAAAATACTAGATTAGTATATAGTTTA
AATAATGAACAACAATTTATTTATCAACAAATTTTACAATCACTACATGAGGAAAAAAATCATCTCTTTTTCATCTATGG
TCATGACAGAACCGGAAAAACTTATTTATGGAATGCAATAATCACAAAAATTAGATCAAATAATGAAATAATTTTAGTTG
TTGCATCTTCCGGAATAGCATCACTACTACTGCCTAAGGGAAGAACTGCACATTCTAGATTTCAAATACCATTGTCAATA
GATAAATTTTCCACAGGTCATATTAAAAAAGGAACTCAATTGGCAAAAGTAATTGATAAAACATCACTTATATATTATGG
GATGAATCACCCATGACTAATAAATATTGTTTTGAAGCATTAGATAAAACACTTCAAGATTTAAGAAATAACTTTGAACA
ACCATTTGGTGGCATGACAATTGTCTTAGGAGGTGACTTTCGACAAATTTTACCAGTTATTCTCACAGGAACAAAGGAAG
ATATAATAAATGTAACTATAAATAACTCTTATTCATGGCCATATTTTAAAATTTTAAAGTTAACAGAAAATATGAGATTA
AAACAATACAACCATACATAACAAGAAACAAAGAAAATTGCAACATTTTTTAAATGGATATTAAATGTTGGAGATGGTAC
TGCTGAAGGAATAAAAGATTTAGAAAATGAAGGCGCTGCATTGGTAAAAATACCAGAAAAATACATACTACATTATGATT
CAAATCCAATTGAAAAAATTTCAACTTCAATATATAATAATTTAAATACTTACTTTAGCAGTATTGAATACTTAAAAGAA
CGAGCAATCATAACACCGAAAAATAAAACAGCTGATGAAATTAATAATTACATATTATCCTTAATTCTTGGACAAGAAAA
ATCTTATTATAGTTACGACACTATTGCATCCTCATCCGAAAACATAGACGAACTTAATCTTTTATATCCTCAAGAATTTT
TGCACACTCTTAACTTTAATGGAATACCACCACATGAATTAAAGCTTAAATTAGGAACGCCTATACTGTTATTACGAAAT
CTAAATCAATTAATTGGATTATGTAATGGCACAAGACTTATTATTATACAATTAACAAATAAAATTATAGAAGGACAAAT
CATAAAATCAAGCAATATTAATGAAAAAGTCTATATCCCAAGAATAGAAATGATTGTACATGAATCTAAATGGCCATTTA
CACTAAAAATATGACAATTTCCTATTAAAATTTGCTATGCAATGACAATAAATAAAAGCCAAGGACAATCTTTGAATAAA
ATAGGATTCTAGATACCGAAATTTTTAACCACAGACAACTATATGTTGCTTTATCAAGAACTACAACTCCAAAAGGATTG
CATATACTAATTCATAATTCAATTAATATATATCCAAATTATATAAAAATATTGTTTACAAAGAAATTCTATATAATATC
AAATAAAGAAATAAAATACAATATAAAAATACAAATATTATAATAAATTAAATATTAGATTCATAATCTTTTTTTATAAT
CAAAATTGCTTACTATTCATCTATCAAAAACATATCGAATAAAGCTTCCTATTTTTATGCACTAAAACAATTACCTTTTT
TGCCAACAGTTAGCCAAAATGATGACATTAATTCGAGCCCTAAAATCAAATGAAGTTTATGAAACTATCACGGCCAGAAT
CTGCAGATTATGGATGAATAATGATCTGAGCACTGGACGTTTGATCAGCCTTGATTGTGTTTTAGTCAATGAAGAGGTAA
TATTTTTTAACAAATATAATATTCTATTATTTTTCATTTAATACCAAATATTATAAATCTAATAACAATAATACCTTTTA
TATCTGCAGCATGAAGCAATTCAAGAATCATTTCGCGCACGAGATTCAGACACTATTTATCAAAAAATTCAAATAGGCAA
TATATATGATATTTACAACTTCTTCGTCACTGAGAACAAATCAACATATAAAGTTGTGCCACATATTGCAATACTACAGT
TTGCCCGCACAACAGTCTTCGTTCCAGTTACAGAAGAAGCACCACCTATTCCAATTCATAGGTTTTACTTCATCGAATTC
GATCAGCTTCAGCACAGAATTCAGCCGACTAAAATCCTAAGTGGTAAGATAAATTACTTTTTCTAAAAAAAATACATCAT
CAATGTATTAATTAATATCTTTAACATTTACTATTTATTTTCCAACAGATGTCATCGGTGTTCTTACAAGAGTGCAAACA
ATTGAACAAACAAATATCAACAATAGACAAACATCTCGACGGACCATAACGATACAAAATATAAGGTAAATTAACCTTTC
ATAGTCATTACCACAATCATATAAAAAAATTTATATTTAATAAAAGTATAAAACTTTTACATCTTTTAAAACTCTTCATT
CTAACTTTTTTATTTTACCTTTTTTTTCTCACAGAAACGAACAGCTTCAAGTCACATTATGGGAACATAAAGCAGGTCAA
TTTGACGAAAATGTCATTAAATCAATGAAAGGACCAGTTATTGCGGTTTTTGCAGCAATGTTGGTGAAACAATATCTAGG
TATTTTTTTAACAACTTATAAAAATAATAACATAGAAAATAAAATATTTACATCTAATATGCCAAAATATTAACATCTAA
TACACCAAAATATTAACCAATTTATTGTTTATGTTTAAGGCAATGCGTATGTATCAAGTACTATGATTAACGTCCAAAAA
TGATAGTCACAAAAAATCAATTGTAGCACAGAAGGGTGGTCGTATCCACAGACAGGTAACAAAATAAACAAGAAAAATTA
GAAGAATAAGAGCGTTAGAGAAAAATAAATAACAAGTGAATTAAAGAAAAAGCATAGTTTTTGAGATTTTTGTTGCAAAT
AAAATAAAAAGGAGAAAATTTGTATGAAGGAAATTCAATAGTAAAAACGGTAAGGGTTGAGAATCCCTAATCTTTCGTTC
ACCAATTCAAGTTTTGATTCACAAAATAAAATAATCGAATAAATTAAATCTCTATGTTGACTCTGAAAATATTATAATTA
CAAGTTATCCAAAATCGACAATATATCAATTTGACATTATTGCAGTAAAAGACAATTTGTAAAATAATTTGAATAACAAA
ATAATGCGTGACAGAATTACATAAGAAAAGCGTGACTGAACTTATATAAAAATTGGCACACAATATTTTGAAAAATAAAT
GAAAGATAGATGAGATTTAATTCATTCAAATATTGAACTTTACAGCACAAGGAATCAAAAGCCCGAATTAGGTCACTCAA
CAAAAGTTCATCTCTAACCTCGCCAAGAGAACTCTAGCCTAGCTTGCAAAACATTCTCACAAGTTCTAGAGAGGAAATAT
GAGACTGACAGCAAGATGAAAGAAAACTAAAAATTAAAAACTTACAAAAACCTTAGGCTAACCCTCTTATTTATAGTGTT
CGGAGGTTGCCTCTCAAATAAGGAAACAAATAATAAAAATAGAAAATTACAAAAGAAAAGGAAACAAAATAAAATTACAC
ATAAATTAGGAGAAATCATATATATGATTTGGGGAAGAAATCTGGCCAATTTGCTCTGATTTTGAAGGAGAAATTCAGAC
TCAGCACTTATTAGACACATGTCGTAACGTGATTGGCAGTGAGTAGACAAAGCACCACGTGGCGCGTGCGGAATGGTTGG
AGCTTGCTGGCGCGGTTAGAGTGGAGGATAGCTGGGGGACAGATGGCACCTGAGTATTTCAAACAAATTGTCAGTAAGGA
GTCAAAAGATACTATCAAGATTATTTCATTTATAACTCCAGAGTCGCATGTGTGTGCTCCAAACCATAACCTTCTTACCA
CTGACCATAACACATACAGTTTTGAAAAATTCACCAAGTAGAAATCCCAACTCTATTGAACATTGACCAAAAGATAGGTT
AATCAACTACTAGAACATTCCATCATTCTTACCACAAATCAAATTTTGGGATTTTATTCGGGTCAAATAGAAATTTACAG
AAACGAACAAAGAGCCAAAAAAATGCTAAGAAAAATAAATTACTCTTCTATTTTTTGTTTTGTTTTTTTGTTTTTTTGTT
TTTTTTGGCAAGAGACAATCTGCAATAATGAAGTGAATGTAGAAAGGTGTTCTTTTGACAAACAAGTATATAGCATCAAA
AGTGATTACAACCAAACTACAGGGTCTGTGAAATGTTGCTCTTACTCAGTTTTTTTTTTTTTAAAGATAAGAAATGAGGC
TTTATTACATAAGATCATTCCTATCTAACCGAAAATCCACCCTCAAGCATATGCACCAAACATATCACTAACCATGTAAT
GATGTTCTAACAGTGATTTTACTAGCTCAAAAGATCAATGAATGTTCAAAAGTCATTTTCTCTACTCTCTTAACTCACTA
AAATTTAAGCACTTAAACTTGAGAATTTTCTCAGCTGACATGCATTAACATCCATCTTACCACAAGGTTTAGCACGTGTA
AAGAGAAACTCTGGAAGTCATTTCTTAGTAACCAAGACAGCAAAAATCGACCCAAACCAATCATTTTGAATCATACTCAG
ACAACTTTGCAAAAATTTTAACCTAAATATCAACATGACAAAAATCACTCTTACGTATGAACATGCTCACCACCCCCAAC
TAAAATCAGATAGTGTCCTCAGTGTCAAAAATTATAGAAATCTAGGGCAAGAAAACACTTGGATGATGAGCATTCCACAT
ATGAGCATAACCTGAGCTTCCTGATATAATTCTCCAAAAACACATATAAAAAAATGTAAAAAGAAGCATAGAAAATAGAA
AATAAAAATATGGTACAGGAGATGTGAGCAAACTACTCAGGGCTGGTAAACGACGTCGTCGAGAATGATCTCTTCAACCT
AGTTCACCCGCTCTAAGTAATTCTTCAGACGCTGACCATTTACTTTGAAGATTCTCCCATCGGTCGGGTCCTTAACCTCG
ACAGCACCATTGGAAAAAATGCGTCTCACTACGAACGGGCCAGTCCACCGTGACCTCAACTTACCGGGGTGGAGATGCAA
ACGGGAATCATAGAGATGAACCCGTTGATTTGGCTCGAAATTCTTCCTTAGGATCTACTTATCATGAGCCGCTTTCATTT
TTACCTTGATCCTAAAATTGCGCTCCTTCAGCATGTTGATCAATCGTCGTTCTTGTAATGCATCGAGTTTAGACGACTTG
ATGACTGGGAATGTGCCTTTATCTCTCAAGAACGCATGTTTTAGGCCCTCAGGTAATTGGGCTAGCTTAACTTTTGGAGC
ATCCTCGGTGGATGATTTCAGTTTTTCTCCCTCTGTTGGGAGCTCTTCAAAACATGGTGGCCCAAACTTGGTTCCTTTGT
CTTGTGAATTGTTGAAAATTGCAGACAAGGGAGCCAACTCAGTAGAACCGGAATTTTCAGAATCAGAATTTTGAAGGAGG
TTTTCAAGATCTTCAAAGTTACTTTGCAGTTGAACCTCCTCCTCGACAAGTGTGTCGATCATGAATGTTTACTGACACTC
ATCGTCATCACGTGGTTACTTTTGAATATGAAAAATATTCACCTCAAGGGTCATTTCCCGACAGATATCTTCATGAGACC
ATTCCTACAATTGATAAGTGTGTTTGCTGTGGCAAGGAAAGGTCTTCCTAGAATGATGGGAATGGATTACTTCATATTCA
CCACCAATTGTGTATCCAAGATAAGAAAGTCGACGGGGTAATAAAACTTGTCAACTTGCAACAGAACATCTTCCACTATT
CCCCGTGGTCTCTTAATGGATCTATCGGCTAGTTGCAGAATCACAGATGTGGGCTTAATCTCTCCAAGACCCAATTGCGA
GTAGACCAAATAAGGCATGAGGTTAATGCTCGATCCTAGGTCTAATAACGCTTGGCCGAATTCGTGTGTCCTAATCTGGC
AGAAAATGGTGGGACAACCTGGATCCTTCTACTTCAGCAGTGTCTTCTGCTCAATCACCGCACTTACTTGTTCCGTCAAG
AATGTAGTTTTCTTGACATGGTACTTTCTCTTTATGGTGCACAGATCCTTTATAACCTTGGCGTAGGCCGGCACTTGCTT
GATCACATGTAGTAAGGGAAGATTGACCTTTAATTGTGTCAAGTACTCTAGGATCTCACTTTGATTTTCTGGAACTTTCC
TAGCAGGTCAGAGAGCGTGGGGGAAGGGCACCTTTACTAGAATTTTTGTTGGCTCTTCTTTCTCCTGAGCTGATTCTTCA
TTACTCGAACTGGTTGTACTTGTCGATGGCGTGTCAAAATTCATACCACTTCAAGTAGAGATGGCATTAACTTCCTTGAT
ATTTTGACCTTCAGAGTTGGAAGTTTGAGCCATGTGTTGTCCTCTCAAATTGGACTGGGCTTGTGATGGAAATTTATCGT
GCTCCTGAACGGTTAAAGCTTCTATCAGCTTTGTGATCTGACTTTTTATTTCCTTAGTCTCTTCCACCAGCTGTGTGAGT
ATTGAATCAACCCATCCACAAAAGCTTTTAGGGTATCCTCTAGAGAATTCCCTTTCAGCTGCATGTTATTCTGAGGCACA
AAATATGTCCTTGGTGGTTGAGATTGTTGCTCTGATCTCCATTGCCCTCCAGATGATTATGCATGTTGGTTTGGATCTCT
CCAACTGAAGTTTGGGTAGTGTTTCCAGCTATCATTATAAGTGTTTGAGAAAGGTCCATAAGGCTTATTGTATGTGCCCA
ATACATTGCACTACTCCTCGTATACCCCCCTCATTTCACCAAAAGTGAGACAATCTTGAGCTAGATGGCCCACTCCACCA
CAAACGAAATAGGACTCATGTGCCTCTGTCCTTGCCACCATGTGGGATCCTTTACTATCTTTACTTTTGAGGGCCTCGAT
TTGCTTCGTCAAAGCTTCAACTTGGGCCTTGAGGCTGTCATCTTCCCTTAATTGATAAACTCCAATGGTCGGGACCTACT
AGTGCTCTCAGTAGCACTCGTTCCAGTCCAAGTATGAGCTTTCTCAGCTAACTCATTCAGGTACTCGATAGCTTCGTCAT
GATCCTTTTGGAGAAAATCCCCATTGCACATCATCTCAACAAATTGGTGCTCTCGGATTGTGAGTCCATTATAGAAATAG
CTTACGAGGCCCCAACTTTCATATCCATGGTGGGGACACAGATTTAACAGATCTTTAAAATGCTCCTAAGCTTGATAGAG
AGTTTCATTTTTCTTTTAAGTGAAATTTGAGATCTGTCGTTTCAAATTGTTGGTCTTATGGTGTGGGAAATACTTGTTGA
AGAATGTCGTCGTCATTTCTTCCCACGTACTAATAGACCTGGGCCTAAGAGAATACAACCAGCTTTTGGCCTTGTCCTTC
AGAGAGAAAGGGAAAAACTTCAATCTGACAGTGTTTGCGGCCTCAGCACGGCTGTGAAAAGTGGCCACCACCTCTTCAAA
CTCCCGGATGTGTACATAGGGGTTCTCGTTCTCTAACCCGTGAAAGTTTCGGAGAAGTGCAATCATGTCTGGCTTGAAAT
CCGTAGGCGGTGCATACGGTGGGAACATGATGCAAGATGGGGTGGCCGTACGCGTTGGGTGCAGGTAATCTTACAACGTC
CTTTGCTGTACTTCCTCGTGTTGTGCCAATGTAAATAGATTTTGACGTGCGAATTCCAACGATGAGTGTGAAGACGGAGG
CGTAGATGACGAGTCGGATAGAATTTCACTAAGGGTTTCTAAGTCTGGACGTTGAGCAAATCTCCCTAGTTCGTCTCTAT
ACCGATGCATTCACCCAAAGCGGTTTTTTTTTAATTTTTACTTTTTTAATTTTTTTTTCTTTTATTTTTAATCAAAACAA
AAGAAAATAATTATATAGTAACGTAAATTGTAACCACCGAGAGTGCTCCCAAGAAACACTATAGCTCTTGGCTCAATGAA
TAGTCTCATAGACAGAGCAACGTTCCCAAGAAAGATTGGTGGGGCGAGGCCCACTTAAGTACCAACTTTTCTAGACAAAA
CTCCCTCAGATTGTGTTGTGCCAATGCAAATAGATTTTGACGTGCGAATTCCAACGATGAGTGTGAAGACGGAGGCGTAG
ATGACGAGTCGGATAGAATTTCACTAAGGGTTTCTAAGTCTGGACGTTGAGCAAATCTCCCTAGTTCGTCTCTATACCGA
TGCATTCACCCAAAGCGGTCTTTTTTAATTTTTTTTTCTTTTATTTTTAATCAAAACAAAAGAAAATAATTATATAGTAA
CGTAAATTGTAACCACCGAGAGTGCTCCCAAGAAACACTATAGCTCTTGGCTCAATGAATAGTCTCATAGACAGAGCAAA
ATAAATAACAAGTGAATTAAATAACAAGTGAATTAAAGAAAAAGAAGAGTTTTTGAGATTTTTGTTGCAAATAAAATAAA
AAGGAGAAATTTTGTATGAAGAAAATTCAGTAGTAAAAACAGTAAGGGTCGAGAATCCCTAATGTTTCGTTCACCAATTC
AAATTTTGATTCACAATATAAAAGAATCGAATAAATTAAATCTCTAAGTTGACTCCGAAAATATTATTATTTCAAGTTAT
CCAAAATCGACAATATAACAATTTGACAATATTGTAGTAAAAGACAATTTGTAAAATAATTTGAATAACAAAACAATGTG
TGGCAGAATTACATAAGAAAAACGTGACTGAACTTATATAAAAATTGGTACACAATATTTTGAAAAATAAATGAAAGATA
GATGAGATTTAATTCATTCAAATATTGAACTTTATAGCATAAGGAATCAAAAGCCCGAATTAGGTCACTCAACAAAAGTT
CATCTCTAACCTCACCAAGAGAACTCTAGCCTAGCTTGCAAAACATTCTCACAAGTTCTAGAGAGAAAATATGAGACTGA
CAGCAAGACGACAGAAAACTAAATATTAAAAACTTACAAAAACCTTAGGCTAACCCTCTTATTTATAATGTTCAGACGTT
GCCTCTCAAATAAGAAAACAAATAATAAAAATAGAAAATTACAAAAGAAAAGGAAACAAAATAAAATTACACATAAATTA
GGAGAAATCATATATATGATTTGGGGAAGAAATCTGGCCAATTTGCTCTGATTTTGAAAGAGAAATTCGGACTCAGCACT
CATTAGACACGTGTCGCAACGTGATTGGCAGTGAGTAGACAAAGTGCCACGTGTCGCACGCGGAATGGTTGGAGCTTGCT
GGCGCGGTCAGAGTGGAGGACAGCTGGGGGACAGATGGCGCGTATTCATTGGGAAGTCCGGCTGACATCACAAGTGTGGG
ACCCGCTTTGGACAGGTGGCGCGCGCGAAGAGAGCGGCAGGTTTACTGTTGTCGTGCGAGACACACGCGAAAAATGGGTT
GGAACGCGCTGGAGATCGCGCACCCTGGGAGTCTCTCGTGCAGGTGACGCGCACAAGGTGGAGTGGGGAACGCGGGAGAG
CTGGGGCCCACGCGAAAATAGCTTGTGGCTTCGGCTCACGCAGCTCTCTCTCTACATGGCTCGGATTGGTTGAAAATATG
ACTTTCATGGCTTCTTCTTATGTAGCTTTTTACACTGCTTTCATCTATAAATAATTAAGCAAAAACTAGACAAATTCTAA
TTAAAAATATTATGAATAAAAATAATTGAATTGTTTAATTAAAGCTTAAATATTTTAATATTATATAAATCAAAAGCAAT
ATTTAGAGTGCATTTTCATGCACTTATCATACTGCAGCAACAATCTTCTATCTTGATCCAGACATACCGGAAACACAAAC
ATTAAAAATAAGGTAAGAAAAAAATCCCCAAACTTTAAAAACAACAAACTTTATGCAAATTTATTCATAATAATTAATTT
TATATACATATAGATTCTCTCAGCAACCTCAAGAAATTGACTTCTCAACAGCATCAGCAGTACCAACACAATCTATTGAA
GAGGAAAAAATACTAAATAGGAGAACAATTGATGAACTAAAGACATTGGATCAGGAAAACAACCAGGTGAGTATCAAAAT
ATTCCATGTATTTCTTTTCCTTTAATTACATTATTTAAGCTAAAAATCTTTCCACATGTATATAAGGCACTAAATTCACA
GTAAAGGCCATTATAACTAAATTCTCAGTAAATTAATGCTGGTACTACAACTCTTGCCCTAGATGTTATCGACAGCTAAA
ACAGGCGGGAACTAATTGGTGGTGTGATAGCCATAGACACATAAAGACAACACCATCTCCATGGTAATTAAAACTATAAA
TATACTCTAATTAAAATTTATTTACTTTGATTAGCAAAAATAAATACTTTATAACCTAAATTATCTATTATCTTATAAAT
TACAGGTATAGGCTAAGCGCATATATTAAGGATCATACTGGAAACACGGATATTACTATATTTTGGCATAGCAGCACAAG
CCTTGATAAAAAAAACAATGCTCAACATTAACAATTAATGAAGGATTTACCGACCCATTCACAATCCCACCAATCATCAA
CCAACTAAGAGGTGAAACAAAGATCTTCCAAATATATTTTCAAAGAAAAGGACCTCAAATTACTACAATTGTCTCAAAAA
TATTTGAAGAAACTGAATTGATAACAACACCACCACAAATATCAACGCTTGCAACATCAACTACAAGGTAAAGCATATTT
ACTCATCTTTATTAATTATATATAAAAAAACATATTTCTTACTTTAAATACATATTTAAACAATATTTTACAGGCTTAGC
CCCCGCTCAAGAACAACAACATCAATAGATTCGCATACACCAGACCCAAAAAAATCAGCCACCAGGTAATACATATTTAC
TATTTTATATTATTTATAAATAAAAAATAATACTTATAATTTTAAATACATACCTTATTAACCTTTTATTATTACAGTTC
CAAGTCTAAAGAAATAGAACAGTCAAGAAAACGTCCATGAACTAGGTAACGTAACTACTTCTAAATCTTACTATTTCCAA
TTATTAATACTAATATCTTTTAAAATTTATATTTTACAGTTGAAAAAAAAATAGAGAGACCACAACAGCAAAGAAGAAGA
AAGAGTTATATATATATATATATATATTGTAAATAACTTTATATGACAATATGTTATATATTTATATATATATTGTAAAT
AACCTCATGTCAAAATATATTTTTTATATATATTTATTGAAAATAACTTCATATAACAATGTCCTGTGTATATATTCATG
TATAAATATACATAAATAATCTACTTCTATTGTATACAAATTATTAACTTTTTCTAAGATACAAAATTACCTCCTACTAC
AATGCGCATAAACGCGCGCGTCCATAACTAG