>DTX_2N_1_Mno length=432;Class=DNA transposons;Order=MITE;superfamily=MITE; AAAAGGCGCCTCACACTCCGATGGCCCACCGGCGAAGTATTGTCCCCACTTGGGCCCGCCGTGACGGGTGGGGTTTTGTC CCTTCGTAAAAGGCGCCTCGCTGGTAGGAGGGGTTGGCACTCTGGACTATACCTCTCCAGACCCCCGTCTCCAACCGATG TGAGATTTGGTTCAACAGTGCGACTCCACTGGGGACGTTTGGCCACGGCCTGCCTCCCCAGTCCCCCCGTCTCGGGGGGC ACTGTTGTACACCAAGAGTCCCACATCGGTTGGAGACGGGGGTCTGGAGAGGTATATGTACCAGAGTGCCAACCCCTCCT ACCAGCGAGGCGCCTTTTACGAAGGGACAAAACCCCACCCGTCACGGCGGGCCCAAGTGGGGACAATACTTCGCCGGTGG GCCATCGGTGTGTGAGAAATTCTGGTATCAAC >DTX_2N_2_Mno length=685;Class=DNA transposons;Order=MITE;superfamily=MITE; CCAGAATTTCTCACACACCGATGGCCCACCGGCGAAGTATTGTCCCCACTTGGGCCCGCCGTGACGGGTGGGGTTTTGTC CCTTCGTAAAAGGCGCCTCGCTGGTAGGAGGGGTTGGCACTCTGGTACATATACCTCTCCAGACCCCCGTCTCCAACCGA TGTGGGACTCTTGGCATACAACAGTGCCCCCCGAGACGGGGGGACTGGGGAGGCAGGCCGTGGCCAAACGTCCCCAGTGG AGTCGCCAACTGTTGATACCAGAATTTCTCACACACCGATGGCCCACCGGCGAAGTATTGTCCCCACTTGGGCCCGCCGT GACGGGTGGGGTTTTGTCCCTTCGTAAAAGGCGCCTCGCTGGTAGGAGGGGTTGGCACTCTGGTACATATACCTCTCCAG ACCCCCGTCTCCAACCGATGTGGGACTCTTGGCATACAACAGTGCCCCCCGAGACAGGGGGACTGGGAAGGCAGGCCGTG GCCAAACGTCCCCAGTGGAGTCGCCAACTCTTCATACCAGAGAGTCCCCACACCTGTTGACGGCGGTCCGGAGAGGTATT GTACCAGAGTGGCACCCGCTGCGACTGGTGAGGCGCCTTTTACGAAGGGACAAAACCCCACCCGTCACGGCGGGCCCAAG TGGGGACAATACTTCGCCGGTGGGCCATCGGTGTGTGAGAAATTC