>DTX_1N_1_Mno length=262;Class=DNA transposons;Order=MITE;superfamily=MITE; TTTTATATATATATATATATATATATAGGTGTAGTTTTAATAGTTACTCTAATATTTATTTATTAATGAGTATTATTATT TTAACTGTAAGATATTAATCTGACGGTTATAATAAATTAGATAGTTGATTAAAAAAATTTATGATAATTAATGAAATTAG ATTCTTATCACGTCACATCATTAAATTTTTATATTTAATAGTAACTACCGATAAAAACGTAACTATTAAAAACTCGTATA TATATATATATATATATATTAT >DTX_1N_2_Mno length=222;Class=DNA transposons;Order=MITE;superfamily=MITE; TATATGGGTGTGGTTTTAATGGTTACTCCAATATTTATTCATTAATGGGTATCATTATTTTAGCCGTAAGATATTAATCC GACGGTTATAATAAATTATATAGTTGACCAAAAAAATTTATGACAATTAATGAAATTGGATTCTTATCACGTCACGTCAT CAGATTTCTATATTTAGTGGTAACCACCGATAGAAACGTAACCATTGAAAACTCGTCTATAT