>DTT_5N_1_Mno length=634;Class=DNA transposons;Order=MITE;superfamily=MITE; GAAAATAGGCCAATATGAAAAGTTTAAGAAAGTATATAGGCCAATTTTTAGTTATAGAAATTAATAGGCCATAACTTGTC AAGTTATGGTTCATAACCAGATAAGTTATGGACAAACTTGTCAAGTTATGGTTCATAGCCAGACAAGTTATGGACAAAAA CTGTGATTATGGACAATAACTTGTCAAGTTATGGTTCATAACCAGACAAGTTATGAACGAAAATAGTAATTTGGCCTATT TATTAACTTATGTAAACTATTGGCCTATTAATTTTAATTCATCTCAAGTCTTGGCCTATTTCCCTCTTTCTCCCTTAAAT TTTTTTAAGGGAGAAAGAGGGAAATAGGCCAAGACTTGAGATGAATTAAAATTAATAGGCCAATAGTTTACATAAGTTAA TAAATAGGCCAAATTACTGTTTTCGTCCATAACTTGTCTGGTTATGAACCATAACTTGACAAGTTATTCTCAATTTTTGT CCATAACTTGTCTGGCTATGAACCATAACTTGACAAGTTTGTCCATAACTTATCTGGTTATGAACCATAACTTGACAAGT TATGGCCTATTAATTTCTATAACTAAAAATTGGCCTATATACTTTCTTAAGCTTTTCATATTGGCCTATTTTCT >DTT_5N_2_Mno length=324;Class=DNA transposons;Order=MITE;superfamily=MITE; AGAGGGAAATAGGCCAAGACTTGAGATGAATTAAAATTAATAGGCCAATAGTTTACATAAGTTAATAAATAGGCCAAATT ACTGTTTTCGTCCATAACTTGTCTGGTTATGAACCATAACTTGACAAGTTATTGTCCATAATTCACGGTTTTTGTCCATA ACTTGTCTGGCTATGAACCATAACTTGACAAGTTTGTCCATAACTTATCTGGTTATGAACCATAACTTGACAAGTTATGG CCTATTAATTTCTATAACTAAAAATTGGCCTATATACTTTCTTAAGCTTTTCATATTGGCCTATTTTCTACTATTTCCGT TTAT