>DTT_4N_1_Mno length=204;Class=DNA transposons;Order=MITE;superfamily=MITE; ATGCTAGGGACACCAACTCAAATCTCAACTTTTGTATACCAACTGATGTGACATGTGAGTTGTCATTTTTATATTGGTGG GTGTTTAAAATATTGTCACGTCAATTAATGATAAGAGATTACATCTACCAATAAAAAGATGACAACTCACATGCCACATC AGTTGGTACACAAAAATTGAGATTTGAGTTGGTGTCCCTAACAT >DTT_4N_2_Mno length=244;Class=DNA transposons;Order=MITE;superfamily=MITE; TAATTTAAATTTTTAATAATAATTAAAAAATATAAAATAATAATAATGCTAGGGACACCAACTCAAATCTCAATTTTTGT GTATTAATTGATGTGGCATGTGAGTTGTCATTTTTATATTAGTGGGTGTTTAAAATATTGTCACGTCAATTAATGAAAGA GATTACATCTACTAATAAAAAAATGACAACTCACATGCCACATCAATTGGTACACAAAAATTAAAATTTGAGTTGGTGTC CCTA