>DTT_3N_1_Mno length=104;Class=DNA transposons;Order=MITE;superfamily=MITE; ATGGCTTTAACAGACTCAAAACGGGTCATATAATATTTCAAAATAAACATCTAGATCTTTATTTTGAAATATTATATGAC CCGTTTTGAGTCTGTTAAAGCCAT >DTT_3N_2_Mno length=84;Class=DNA transposons;Order=MITE;superfamily=MITE; AGACTCAAAACGGGTCATATAATATTTCAAAATAAACATCTAGATCTTTATTTTGAAATATTATATGACCCGTTTTGAGT CTGT