>DTT_2N_1_Mno length=182;Class=DNA transposons;Order=MITE;superfamily=MITE; GGCTATTTTACTCCATCAATAGGAATTGTGTTTTAACTGTTGGATTAATTTTTTAACAGTTTGATTTGCAGTAGGAGTAG TTTTGTATCGCACGTTGTAAATTTTTAATATAAACATGTACAAATCTAACTGTTAAAAAATTAATCCAACAGTTAAAAAT AATAATTTCTATTAGTAGAGCA >DTT_2N_2_Mno length=151;Class=DNA transposons;Order=MITE;superfamily=MITE; GGGATAAGTGTTTTTAATTGTTGGATTAGTTTTTTAACAGTCAGATCTGTGCAGGTCTGTATTAAAAATTTACAGCGCGC CACACAAAACTGCTCTTGCTGCAGATCTGACCGTTGAAAAATTAATCCAACAGTAAAAACACTTATCCCAC >DTT_2N_3_Mno length=121;Class=DNA transposons;Order=MITE;superfamily=MITE; TACTGTTGGATTAATTTTTTAACGGTCAGATCTGTAATAAGAATAGTTTTATGTGGCGCGCTATAAATTTTTAATACAAA TATATACAGATCTAACCGTTAAAAAATTAATCTAATAGTTA >DTT_2N_4_Mno length=120;Class=DNA transposons;Order=MITE;superfamily=MITE; GCTATTGGATTAATTTTTCAATGGTTTGATGTGTAGTAAGAGCAGTTATGTGTTATGCACTACAAATATTTAATATGGAC ATTCACAGATTAAACTGTTAAAAAATTAATCCAACAATTA