>DTT_1_1_Mno length=811;Class=DNA transposons;Order=TIR;superfamily=TcMar; ACCTCTATAAANTAATATTGTTGGGACTAAAAAAAATATTATTTTAANGAGATTATTATTTATCGATAAATGAATAATTT ATTAATTTATCGATAAATGAATAATTTATTAATTTAAGAAGAGTTTTATATTTTAATAACTTTCGTACATGTACTTTTTC TTTTACCAAGATTCATGTATGAGTTATAAATAAAAAAAATAGTGGTATGTAGTCAAAAATTAATATGTTTACATATAGAA TTTCAAAAGTTATCATGTCATATAATAAAAGTTATATATATGCAGTACATAGAAGCCTAAAATTAATGTAAGTACATTGT ACATAGAATGTTAATAAGTACATATAGACATAAAATTGATCATGATTCAGATGACAATTGTATTTTATCGAATGTTTCTC CAAAAGAGGCGTTTCAAGCAATAGTAACCTTAAATAACTACTTGCTACAACATGAAAAAAATATACCAGATGTNGTGCAT GCTTTGTAAAAAATTAAAGACGAGGTTGAGTTCAATTTAGGTACAAAGAAAAAACAAATGACTTTAGATGCATATTTTGT AAAAGAGTTGAATTGAGAAAATAGAAGTTGTCAAGAAAAAAACTCTTTAATATNATGAATTNTATATGTTTTTGTTAATT ATTAATTTATATTTTCGTTGGGCCCTAAAGGATTTGAAAAAAAAATTATTATCTTATGCATTTAGCGAGATTATTAATTT AGTACATTGGCCCGAGTCGGGACCGAAAGATTTTATTATTTAATCGAGGTTATTAATTTATCGAACATTCATTTATCGAG ATTTTACTGTA