>DTT_1N_1_Mno length=124;Class=DNA transposons;Order=MITE;superfamily=MITE; AGAGTGCATGAGTCTGGACTTTTACCCTTTATTCTTGATAAATACCCTTTTGTTAGTGTAATTATTTGACTAAAAAGGTT ATGAATCAAGAGTAAAGGGTAAAAATCCTGACTCATGCACTTTC >DTT_1N_2_Mno length=124;Class=DNA transposons;Order=MITE;superfamily=MITE; AGAGTGCATGAGTCTAGATTTTTATCTCTTACTCTTGATTAATACCCTTTTGACTAATATAGTTATTTGACTAAAAAGGA TATTAATCAAGAGTAAGAGATAAAAATCCAGACTCATACACTCT >DTT_1N_3_Mno length=110;Class=DNA transposons;Order=MITE;superfamily=MITE; TGAGTCTGGATTTTTACCCTTTACTCTTGATTAATATCCTTTTTAGTTAAATAACTATATTAGTCAAAAGGGTATTAATC AAGAGTAAGGGGTAAAAATCTAGACTCATG >DTT_1N_4_Mno length=138;Class=DNA transposons;Order=MITE;superfamily=MITE; ATCCTTAAGAGTGTATGAGTCTGGATTTTTATCCTTTATTCTTGATAAATACCCTTTTATTAGTATAATTATTTGACTAA AAAGGTTATGAATCAAGAGTAAAGGGTAAAAATCCTGACCCATGCACTTTTAAAGGGT >DTT_1N_5_Mno length=93;Class=DNA transposons;Order=MITE;superfamily=MITE; AGATTTTTACCTCTTACTCTTGATTAATATCTTTTTAGTCAAATAATTATATTAGTCAAAAAGATATTAATCAAGAATAA AAGGTAAAAATCC >DTT_1N_6_Mno length=129;Class=DNA transposons;Order=MITE;superfamily=MITE; TGCATGAGTCAAAATTTTTACTTTTTATTCTTAATTCATAATTTTTTTAGTTAAATAATTACACTAATAAAAGAATATTT ATTAAAAATAAAAGGTAAAAATCTAGACTCATACATTTTTAAAAATAAA