>DTM_8_1_Mno length=2546;Class=DNA transposons;Order=TIR;superfamily=MuLE; TTAGATAGTTGTTTGCTGGGTGCATAAGTTTGCTGAGAAGAATCGATATGTCACTGTTATTATTTTACGTTGATTGTCTG TCAACTTTTCAGGTATCCCTGAAATCATAACCTCGTGGTAAATTATTTTCATCATGGACATAGATCTCAGGCTGCCTTCT GGTGGGACTGACAAAGATGGTGAAGAACCAAGTGCCATTGATAACATGCTAGATCGTGACGAGAAACTACATAATGGAGA TATTATGACTGGAAGTATTGTTGAGATGGGAGATGAAGTAAGGGCTGAAGATGGCGGAGATTTGAATTCTCCCACGACAA ATGTGGTAGTCTTTAAAGAAGATACAAATCTTGAACCGCTTTTTGGTATGGAATTTGAATCACACGGGGAGGCTTATTCT TTCTATCAGGAGTATGCCCGGTCTATGGGATTCAACACTGCGATCCAAAACAGCCGGCGGTCAAAGACATCAAGAGAATT CATCGATGCGAAGTTTGCTTGTTCGAGATATGGGACCAAGCGTGAGTACGACAAATCCTTTGATAGACCACGTTCCCGGC AAACCAAACAAGACCCAGAAAATGCAACTGGTCGACGATCACGTTCAAAGACAGACTGTAAAGCTAGCATGCATGTGAAG AGGAGGCTAGATGGGAAATGGGTTATACATAACTTTATCAAGGATCATAACCACGAACTGTTACCGGCACAAGCTGTTAG TGAGCAGACAAGAAAGATGTATGCTGCCATGGCTAGGCAATTTGCTGAGTACAAAAATGTGCTTTGTTTGAAAAATGACC CCAAAAATCCATTTGATAAAGGTCGAAATTTGGCACTAGAGGGAGGAGATTTGAAGATTTTGCTTGATTTTTTCACACAC ATGCAGAATGCGAATGCTAACTTCTTCTATGTGATAGATTTGGGGGAAGATCAACGTCTCAAAAATTTGTTCTGGGTTGA TGCCAAAAGCAGGCATGACTATACCAATTTCAGTGATGTAGTGTCCTTTGATACCACCTATATTAGAAATAAATATAAGA TGCCTCTTGCTCTATTTATTGGAGTGAATCAACACTATCAATTCATGTTGCTTGGATGTGCTTTGTTATCAGATGAAAGC GCATCGACACTCTCTTGGTTAATGCAGACGTGGCTGAATGCAATGGGTGGTCAAGCACCAAAGGTTATTATAAGTGACCA TGACAGAGTGTTGAAATCAGTTATTTCACAGGTCTTTCCAAGTGTTCATCATTGCTTTTGTTTATGGCACATATTGGGGA AGGTTACTGAAAATCTTGGTCATGTAATTAAACGACATGAAAATTTCATGGCAAAATTTGAAAAATGCATTTACAGGTCA TGGACAGTTGAAGAATTTGAAAAGAGGTGGTGGAAAATTCTTGATAAATTTGAACTCAAAGATGATGAATGGGTTCACTC ATTGTATGAAGATAGAAAACAATGGGTTCCAACATTCATGAGGGAGGCTCTTTTAGCTGGAATGTCTACCATACAACGAT CTGAGAGCGTAAACTACTATTTTGACAAGTACGTGCATAAGAAGACCACTGTTCAAGAGTTCTTTAAACAATATGAAACA ATTTTACAAGACAGGTATGAAGAGGAAGCTAAGGCAGATTCTGATATGTGGAACAAGCAGCCCACATTAAGGTCTCCTTC CCCTTTCGAGAAAACTGTTTCTGGGGTTTATACAAATGCTGTGTTCAAGAGATTTCAAGTTGAGGTTGTGGGTGCGGTTG CTTGTCATCCAAAGAAGGAAAGACAAGATGAGATGGGCGTTGTGTTTCGAGTTCAAGATTTTGAAAAGAACCAAGACTTC CTTGTTTCGTGGAATGAGATGAAGTCAGAAGTTTCTTGTTTATGCAGGTTATTTGAATACAAGGGTTATCTTTGTAGACA TGCTCTGATTGTTCTCCAAATTTGTGGCGTGTCTGCCATCCCAGCCCAATATATTTTAAAAAGATGGACAAAAGATGCAA AGAACAGGCATTTGACAGGAGAAGAATCCAACCAAGTACAATCTAGGGTGCAGCGGTACAATGATTTATGTCAACGGGCG ATGAAATTGAGTGAAGAAGGTTCTCTATCACATGAGAGTTATAGTCTTGCTTGCCGTGCACTAGATGAAGCTTTTGGAAA TTGCACGAGTGTGAATAATTCTACTAGAAGTCTTGCAGAAGCTGGTCCATCAGCCACTCATGGCCTACTGAGCCTTGAAG AGGATGCCCAAAGCAAAAGTATTGGCAAGACAAATAAAAAAAGGACCCCAGCGAAGAAAAGAAAGGTTAGCTGGCTAACT CATGATATGTCTTTGTTTTTCCTTTTTTGGGGCAGATTATATTCCTGTTGGCTGATAATAATGGCATTCTCTATTTGCAG GTGAGTTTTGAGCCGGATGTTATTACTGTTGGGACACAAGACAGCTTGCAACAAATGGTTTGTCCTATTTCCTGATTACT GAGCATTTGTTATGAAATAGTTTAATGTGCATTTCAATTAGTATTACAATAACTAATACTATCTTC