>DTM_6_1_Mno length=2510;Class=DNA transposons;Order=TIR;superfamily=MuLE; TCCTATCGTGGAGCCGAATGAGTGCTATGAAATATATGAAAAACAACTATTCAAAAACAAGGATACTTTGAGTAGAACAA TTTCCATGATAGCACTCAAGGAAAAATATCAATATAGGGTTTTCAAGTCCGACAAAACAAGAATAATTCTGCGTTGCGTT GATGAGAATTGCAAGTGGAGGGTTCGGGCAACAAAGTACAACGAAACAGATATGTTTCAAGTGACAAAATATAATGAAAC ACATACTTGCTCCTTGGATCTCCTCCAATGCGACCATCGGCAAGCTAGTAGCCAAATAATAAGTGAACACATAAAAAAAA AGTACGAGGAATCAGGGAGAACCGTTTATGCACCCAACAACATCATCGAAGACTTGAAGAATGAATTTGGTAAATACATA AAGTCTTACCTGAAGATATCACGGTATATAATTGACTTCCTTTTTAAGTTAATTATCTGCCCAGAAAATATTCTGTCAGG TTCCAAAATGTATTCTCTTCGAATATTATGAGGTTATATGATTGAAGTTTTTTCAATTAATCTGTTAAGATTGAATTTTT TTAACTAATCTGTTCAAAAATTTTATCAGGTTCCAGAAGATATTCTTCTGAAATATCTCATGTAACAAAATTGGAAATGG TTGTTAATTATCTGCGCAGAAAATAAACAGAATACTAAATGTATTTTGTGAAATATTTTTATGATATAAATCTTAATTCC TTTCAGTTAGTAGTCTATTTGATCACCTAATATTATATGACCATACACAGGTATTGATGTGAGTTATGAGAAGGCGTGGA GAGCCAGAAAGATAGCACTAGAGAAGATTGGAGGTGATGTGGACAAATCCTATGAAGAACTGGCCTCTTTTCTATACACG TTGAACAAAACAAATCCAGGATCTGTAGCCGACATAGTTCTTGATGATGAAAACAAGTTTAAATACATGTTCATGGCGGT TGCAGCATCAATACATGGGTGGAAACATTGCAGGCCAGTTATTGTGGTGGACGAAATTTTCCTAGAGTGCAAGCACAGAG GGTCATTGTTGTGTGCGTGCGCAGAAGATGCCAACAACCAAATTTTTCCACTGGCCTTCGGTATTGGCGAATCAGAAAAT GATGAATCATGGGAGTACTTTTTCAAGAGACTTAGCGAAGCTTTTAGTGAAAGAGACGGGATGTGGATTGTGTCCGATCA ACATCCTAGCATCCACGAGGAAGCGGCAAAGTCCTATCCAAATGCATTGCTTGGGTATTGCAACTGTCAGCTTCTTCAAA ATTTAGAGGTCAAATTTCGCGGTGTTTCTAAAGCACTAGCAGAAAACTTCAAAGGAGCTTCTGGGGCATATGACAAAGAG GAGTTTGAGTTCTATATGAGCAAATTGGATAAAGCACATGGTGGTATCAGGAAGTACTTAGAGGGCGTGGGACTTCAAAA ATGGGCTAGGGCATTCTCCCCAAAATCAAGATATGGAGTTATGACGTTAAATATAGCAGAATCAATGAACATCCATGACG AGAATGTTAGGGACATGCCGGTGGCAACACTTATGGAGTGGCTTCGATCAATGCTTCAAGATTGGTTTTGCATAAGAAGG CAGAACGCAGAAGTTGCATCCACAAAATTAGCAGAAGAAGCAGAGAACGAGGTGCGAAAAAACTTTGAGGAGTCGTCAAA ATTAACGGTAACTACTTATCAACACTCTACAAAAATAACATGCCGAGTTCTGGTAGAAATTTTTGTTTCTGTTGAATGAA ATGATTTGCTTTTGTAGTATCAAAATAAGTAATGCGATTGCATGAAACAATGTTCTATTTTTAGGGAATCAATTCATTAA GTTAAATATCTGAAAAATTATCGTTCAAGTTCATGAAAAGCTATAGTTCTGTTGTTATTACATGAATTAATTTTCATTTT AATTATTATTTTAAAAATAATATACCGAGTTAAGGAACCAATTTTGGTGAAATATTATTTTGTTTCTGATGAGTAACGAA ATTATGTGTAGACCAAACCAACGAATGATGACATATTTGAAGTTTATAACAAAAACAAGAGCTGGGTGGTAAACATGAAA CAGAAGACATGCACATGCGGTCGATTGGAACACGATCAACTACCATGCTCCCATTCCATTGCGGCAAGTAACAAGATGAA CATGGGCATATACAAGTATTCTTCGTACTACTACACAAACGAGGCACTCCAAAACACTTACCACCATACAGTTCACCCAC TTGGAGACTCATCAACATGGAATGTGCCGGACAACATAAAAGCAATGAAGATATTTGCACCCTCGACAAAGAACCCACCA GGAAGACCGAGAACCAACAAAATACCATCAGCGGAGGAAACCGAGAAAACAAAAGTAAAATGTGGCAGGTGTGGAAGGTT CGGGCACAACAGGAAGACGTGCAAATGTTAGGATTGATGCACAAAATATGTTAGTTATTTTAGTTGAAATGACTAGAAAC AGATTCTAGTACATGAAATATTTACAGGGT