>DTM_4_1_Mno length=2549;Class=DNA transposons;Order=TIR;superfamily=MuLE; CTGTTTGTATAATTTTGTTGAACATTAACGTAAAAAAAAAAAAAAAAAAAAAAAAACACCAATACGCAAGAATATCAAAG GGTATTCATTTTAGTTTGAGTTTTTAGTTCTCAGAGTCAAAAGGGTACTTTTTGGTTTTTGTTCTCTCAAGGTTTGAACG AGTATAACAACTGCAAAACTCATGGAAGTGGAGCAACAGTCCGATGAAGCTAAAGAAATAGAAAGTTCTTATGAGTCCAT GGAGGACGAGGTCGAGGAGTATTGTGTAGTAGAAGGTGCTGAAGCAGTTCCAATGTGTTTATCAGGTGGGGTTATAGTGG AGCCCACGTTGGGCATGGAATTCCCCTCTGAAGATGACGCCAGGAATTTCTACAAAGCCTATGCCAAGCAGACGGGTTTC AGCATTCGTGTCAACTCCTATTACCGATCGAAGAGAGACAATTCGATTATATCGCGGGAGTTTTGTTGCTCGAAAGAAGG ATTCCGTCGCGAGAAGAGAGGGAAGAAGGTGGATTTGGTGGACGGCGTTAAGAGGAGGCGTGCTAGGCCTATCACTAGGG AAGGTTGCAAGGCGCTGATGACGGTGAGAAGACGAGAGAATGGGAAGTGGTATGTGGCAAAGCTAGAGAAGAGACACAGC CATGAGCTAGTCACTCCGTCAATGAGGCAATTTCTTAGATCACATAGGCCTGAATGTGATCCAAACAAAAGTTTGAATGA TTCGGGTTTGAGTATTTCTTTGAGAGATTTTGGTGAAGTTAGCGGTAACAGTTTTGGCAAAATGCATTTTCCTGTAGAGG GTAGTGTTAATTATATTGGAAAAGGACGGTTGAGCACTTTTGGGATTGATGCTCGAAGTCTGCTCCGATTTTTTAAGGTT ATGCAAGCTAGTGATCCCGCATTTTTCTACGCTATTCAGGTTGATGTAGAAGATAGGCTAAGTAGTGTGTTTTGGGTTGA AACGAGATCAAGAATTGCCTACAATTGTTTCTCTGATGTTGTGGCCTTTGATACTAGTTACCAAGTGAATCAGTATAAGA TGCCGTTTGCGCCTTTTACTGGAGTGAACCACCACAAACAATCTGTGCTGTTCGGTTGTGCTTTGCTTGCAGATGAGAGT GAATCCACTTTCATTTGGCTCTTCACAACTTGGCTTGAGGCGATGTCTGGACAACAACCGGGTTTGATCGTCACCGACTA TGATTTGGCTATAAGTAGAGCAGTGCAACAAGTTTTTCCACATTCAAGCCATAGATATTGCAAGTGGCATATCATGAGCA AAATACCAAAAGAACTGGGAATGATATACAGTGCACTCCCAAGAACCTTTCAAGTGGAGTTCGAAAGAATTGTCAATAGG AGCGAATCGCCAGACGAATTTGAATCTTCTTGGCAGGGGCTTCTTGATAAGTACAATCTTAGAGGAAATGATTGGCTTCA ATCACTTTACATTGACCGCAAATTGTGGGTTCCCACACTTGTAAGAGACACATTCTTTGCAGGCATGCATGCAGCCCAGA GAAGTGGAAGTGTGAGCTCACTCTTTGATGGCTATGTGAATGCAGGGACTACCTTACGAGATTTCGCGGAGCAATATGAA AAGGCTTTGAATGATCGGTATGAGAAAGAAGCGAAGGCGGAGTTTGAGACATTCTATACTAAACCGGTTCTGAAAACGCC GCTACCTGTGGAAAAACAAGCAGCGGAACTGTACACAAGAATGATGTTCTCAATATTTCAGGATGAGGTTTTCGAGTCTC TTGTGCTTTCTGTCAAATCCATCAGGGAGGACAACAGGACCACAAAATATGAGGTAGCTCGATTCGATGAAGAACATAAA CTGTACTTTGTGGACCTTAATGTTGATGAACAAGTCGCTTGTTGTAGCTGCAAAATGTTCGAATTTGAAGGGATTTTATG CAGGCATGTGCTTGCAGTGTTCAAAGCGACAAATGTGTTTATACTTCCACAGAAATACATCTTAAAGCGGTGGACAAGAA GTGCCAAGGATGAGGCTATGTCGGACGATCTTTTCGGTGTTGATAAGCAGGTTAATTATCAAAAGGGGAAGATGTTGAAG TACAATATTTTGTACCAGGAAGCCATTAAATGTGCAGAGGAAGGAATGACTTCAGACCATATTTTTAAGGTAGCACTAAG TGCCTTGAGAGAAGCTAGGATTAAAATTGTTGAAACTAAGAAAAATGCCATGAGAGAGAATAACAACAACCATATTGCAA GGCAAGTAGATAGTTCACTGATAATTACAACCCCTCTTGAAAACCACAAAGATATAGAGAGAGAAACTTGTGAGGACAAT GACACGTCTAAATATGTGCCAAAGCAATCCTCTAGTGGAGTTGGTTTGTGTAGTAATTGCAACTGCCCTGGTCATGATAG TCGTTCTTGTCTGTGGTTGAAGGATTCGGGTTTAAGTTTCAAATAGTGGTAAGGTCTTCTTCTTCTTCTTCTTCTTGGCT ATCTTTATCAAGTTGCTTCTTTTGTGGGAAAATTGAAGTCTAAGTTTGTTGTAAAGAGTTTTGTACTAT