>DTM_3_1_Mno length=2548;Class=DNA transposons;Order=TIR;superfamily=MuLE; GTAATTAAATATTTCTATTTTGTTTTTAAGAGAAGTGCTCTATTAAATAAATTATTAAGAGTTTTATTTTTTATTTTATG ATTTTTTTATTATGCTATAACAAAAGATATGGCAATAATTTTTTTTTTTTTGAAGGTTATGGATGACATTAATTTTCTTT CGGAAGAATGTCAATCTCGTAAGAAGATGGATTTTGACAATGAAGATAATGATATGTTCTTAGACACCACGAGAATATCG GAGGTTGAGAATGAGAATATTGAAACTAAATTTAACAGTAATGAAAAAATTGCACATTCATTCCAAGATCCCGGATAGTG TGATACCAAAAATTGATATGGAGTCTAAAACTGAGGAAGACTCTTACAACTTTTATAATAATTATGCTCACAAAGTAGGT TTTAGTATTCGGAGAAGTAAGGGATGTAAAGATACTAGTCTTGGTAAGATAATGAATAGAACATTTTGTTGCTCTAGCGA ACATACTCGTCAAGTAGATAAATGACATCTTATTGTGAAATATCATCATGCCAAAACAAGGTTTGGTTAGCTTGCAAGAA TGAAAATCAATTGTTGCCAAATTGATAAATATCGTGTTGTCAAGTTTATTGCTGCTCATACACATGTGACATCAAGCCCC AACAACAATAACTTGCATTGGTCTTAAAGGATATTTATTGCCACCCAAGCAGCTGAAATTGATTTAGTTGACAACTCAAG AATTGCTCTGAGAGCGAGCTGCAAATTAATGACTAGGAGAGCAGGTGGGCCTAAAAGTCTCAAATTCACTTACGATGATT ATCAAAACTATTTATGCCGTAAACGGACAATTCAAATGATGTTAGATGAGACAGCAGGCATCCTTGCATATCTTCAACGC ATGCAATTGGAAGACCCTTCTTTCTTTTATGCTCTACAGTTAGATAATGAAGGGTTGATTCCTAACATCTTTTGTACAGA TGCAGAAATGAGATTAGTGTTCTCTCATTTTGGTGATGTTGTTTGCTTTGACGCAACTTATAAGAAAAATCAAGAAGGTT GGCCTTTCGCTATGTTTGTTGGGGTTAACCATCATAAGCAAACTCCTATTTTTGGAGCTGCACTTCTATATGATGAGACG ACGGAAACATTTATTTGGTTGTTTAATACTTTTACTCAAGCAATGATAGGAAAAAAACGCCAAGAACAATTCTTACCGAT CAAGATGCAGAAATGGTAAAAGCAATCGCTTTCCAGTGGCCAGAAACAACTCATCGCCTATGCATTTGGCATTCAGATCA AAATGTTGCAAAACATCTTAGTGGAGTGTTTGAGCGCTCTCGAGAATTTTTTACAGATTTTAGTTGGTTTATATATGATT ATGACGAAGAGGAAGAATTTTTGGAAGCTTTGCATGGGATATTTGAGAAATATCATCTTCAAGATAATGAATGGTTGAAG CAAATTTTGAGTTTCAAGGAGAAATGGACGTTAGTCTGTGGTAGGAATATTTTTTGTGCAGATATGATGACTACTCAACA CAGTGTAAGTATGAAGAGCTCTTCAAAATGTTATGTCAGCTATAAACATAATCTACTGTAGTTTTTTCACCATTTTTAAA GGTTGATTGAGAACCAACGTTATGAAAAGTTAAAGGCCGATTTCAAAGCAACTCAAAGTAATATATTGCTATCACTTGAT ATCGCAATTTTGAAGCATGCAGCTTCCATTAGTGTTCAATGTATTTGAAACTGAATTGGGCAAAGCTTATCATTGTGCCA TGGAGATGTCTCTCGAGGTTGGAAGAGTAACAGAGTACAAACTTTTTCGTCTTGGAAAACGCTCTTGTCATACTGTTAAA TATGACTCAACTAATGGGATGGTAATTTGTAGTTGCAAAAAGTTTGAAATTGTAGGGATTTTGTGCTCACATATTCTTAA AGTTCTCTTTGAAAAAAATTATGAAAATTCCTGCTCAATACATTCTAAGAAGATGGACAAAGCATGCAAAGAAAGGAATG ATGACAATGCCTACAAACAATAATTGTATGACTAATGAGGATCCTAAGGCACAGATTGAGTCTCCTACTCAAACTACCAC ACATAACCGCCGTGAGGATAATGTTGTTGATGGAGTTGCTAGAGTAATAGGAATTAAGCATAAGGGAAGAGTTTGTGGGA GCTCTGTTAGGCCAAAAAGTGCTCTTGAAGAGGCCAAAACAGAAGAAAAAAAAATTGTCTAAACTCAACAGGTATGTTTA ATCAACTTATTATCACATCTTTGAATTATAATAATAAAAACAATACCTTACGTTATTTTTTATGAACATTTTGCAGGTTT CTTCTGATCTTATTGTGCACGAGCAATTTAATAATGAAGTACTAAGTAGAGGTGTTACCATTCCAACTTAACAAAATCCC CTACTGCTTACACCAACATCTAACCTCAACCAAGTAATTGTCAAAAATTTTATGGACTTAAAATATGTACTTGATATACT ATCCTATAAAGTTAGTAATTACATTATGTTAAATGCAGATTGAATCTCATGTTGATTTTAGAGATCTT >DTM_3_2_Mno length=2519;Class=DNA transposons;Order=TIR;superfamily=MuLE; TCCCCTAAACTCCAAACGTTAATAACAATCCACCCATCTCGTCATTTAAATAGACAGATAATATGTTGTGGCATTAAAAC TTTTCATACCTTTTCACTTTGCCCTTAATTTTTGAAATAGGTCACCACCTCGCACCTTGCGACTTTGCCCACCACTATTA ACCAACCCACGCCACGCCCAAGAACACCCCTCTTTTCGCACAACTCTGGCATGCACGAGATCTCCTCATCCTCAGCAAGA GATCCCAATGATGACATTGGCTTGTGTGAGATCCCAAAATGAAAATATGGATGTTCGTAGAAATATCTCTACTTAAATTT GACAAATATATCGGTAAAAATATTGATATCTGTAGAAATTGGTGTAAAAAAAAGAGAGAAATGTTGGTTTTTTTTTTTTT TTTTAAATTTGAATGGATGGTTGAAATTAAAATATTTTAAAGATGCTTTGCAGCATTTTGAAAATGAGAATGTTGAAAAT ATCAGAAGTTAAAAATATCGGTACTGAAAAAATTGCGTCCATTCATTCCAAGATCCTGGATAGTGTGACACCAAAAATTG ATATGGAGTTTGAAACAGAGGAAGACGCTTAAAACTTTTATAATGATTATGCTTGCAAAGTAGGTTTTAGTATTCGGAGA AATAAGGGACGTAAAGATACTAGTCTTGGTAAGATGATGAATAGAACATTTTGTTGCTCTAATGAAGGTAATGGTCAAGT AGATAAACGGCGACTTATTGTAAAATATCCTCGTGCTGAAACAAGGTTTGGTTGTCTTGTAAGAAAGAAAATCAATTGTT GCCAAACTGGTAAATATCGTGTTGTCGAGTTTATTGCTGCTCATACACATGTGACTTCAAGCCCTAACAAGAGTCACTTG TATAGGTCTCAAAGGAGATTGACTGCCACCAAAGCAGCTGAAAATTGATTTAGCAAACAACTCAGTAATTGCTCCGAGAG CGAGAGCTGCGAATTAATGTACTCTCATTTTGGTGACGTTGTTTGCTTTGACACAACTTATAAGAAAAATCAAGAAGGTC GGCCTTTCGCTATGTTTGTTAGGGTTAACCATCATAAGCAAACTACTACTTTTGGAGTTGCGCTTCTATGTGATGAGACA ATAGAAACATTTATTTGGTTGTTTGATACTTTTGCTCAAGCAATGACAGGAAAAAAACCAACGACAATTCTTACCGATCA AGATGCAGCAATGGCAAAAGCACTAGCTTTCCAATGGCCAGAAACAACTCATCGCCTATGCATTTACCATTTATATCAAA ATGCTGCAAAGCATCTTAATGGAGTTTTTGAGCGCTTTCGGGAATTTTCTACATATTTTAGTCGGTGTATATATGATTAT GAAGAAGAGGAAGAATTTTTGGAAGTTTGGCATGGGATGCTTGAGAAATTTCATCTTCAAGATAATGAATGATTAAAGTG AATTTTCAGTTTCAAGGAGAAATAGGTGTTCGTCTATGGTAGGAATACCTTTTGTGCATATATGATGACTGTTGGAAAAT ACGACCTCGAGTATGCAGTAGAATTTTAAAAAAATTTAAATCAATGCCAAAGCCAATCAAGAACATGTTCATGATGCTAT ATAACATAAATACTAAAGATCTAAATCATACCTTTCGAGATTTAGGAAACTGCACGTTTGATAGATCAAAGCGTTCCAAA CAGCAACCGAAACAGCCTCAACCAACTGGTCTTCTTGAGAATTAAATAATTTTTCCTCTCAGGAATCTTTTGCCAATAGC CCCCCAAAAGTCTCTTAAGTGATCTAATGAATAATGTGACTTAATAGGCTATTTATAGTATTTAGGAAGTCATATTTCCA TAACAATTATATTTCTCAAAGTTTATCTCACTTATAAAGTCAGTTTCGCCACGTCAGCATGCGTTACACGTTACAACCAA TCGACCGGTGACGGAGATGTTATAACTGTTAGCGTTTATGTTCTTAGGAATAAATGTAACGATGTTCTTTTAGAAATTTT GACTATTAATAAAGATTTATTTATTTCATATATCTATGTATTTTCCTCTTTATGTTCATAATAGTTCAATGTATGATGAG CAAACTAAAAGTCTGAGACTGTCATTCTAAATCTTTAGATCATGCATGTAATGTGAAGAACATGTGGAAGACAAGAATCT AAAGATGATAGTCTAAATCATATGATCCACAATCGATGGAATAAAGTTGGGCGCTTTATTCATGTTAAGATTCTCATGTT GTCTACTTCCTAACGGAGACGGTTTGTCTTGGTCGTCGGAGATGGGACTCCATGGGTAGAGACATTGATATAGTTTCTAA TGGTGAAATCTATATTGGATCGGACCAAAGTTGAATTGTTGTAATTAATAATTCTGTTTGAGTAAAACAATTCACTTTTG ACGAATTATATGTGGTCATCTTAATCCTGAGATGGATAATGAACCCGTATGCTTGACTTGTATCATTTGATGTACTAAAG GGAGACATCCTGACATTATGTAAAGCTACGCTTACCGGT