>DTM_3N_1_Mno length=272;Class=DNA transposons;Order=MITE;superfamily=MITE; GAGGAATTATTCAGTACACCGGGTGTACCACGTCATATTATTTATGTGGTACACCCGTCTAATGAGATTGTATCATTTAG ACATTTTGTCTATGTCAGCTTTTCACTTTTATTTTTCTCTTTCCTAATAGGTATTATTGAATACCTATTAAGAAAGAGAA AAATAAAAGTGAAAAACTTATTGGAAAAATGTCTAAATGATACAATCTCATTGGACGGGTGTACCACATAAATAATATGA CGTGGTACACCCGGTGTACTGAATAATTCCTC >DTM_3N_2_Mno length=286;Class=DNA transposons;Order=MITE;superfamily=MITE; GGAATTATTCAGTACACTGAGTGTATCACGTCATATTATTTATGTGGTACACCCGTCTAATGAGATTGTATTATTTAGAC ATTTTGTCTATAAGTCATTAAAATAAAGAAATTGAGTAGAATAATAAGTGCTTTTGACTCAATAATCAATACAAATACCT ATTAAGAAAGAGAAAAATAAAAGTGAAAAACTGACATAGACAATGTCTAAATGGTACAATCTCATTAGACGAGTGTACCA CATAAACAATATGACGTGATACACCCGGTGTACTGAATAATTCCTC >DTM_3N_3_Mno length=335;Class=DNA transposons;Order=MITE;superfamily=MITE; GAGGAATTATTCAATACACTAGGTGTATCACGTCATATTATTTATGTGGTACACTCATTTAATGAGATTATATTATTTAG ACATTTTATCTATGTCAGTTTTTCACTTTTATTTTTCTCTTTCTTAATAGGTATTTACATTGATTATTGAGTCAAAAGCA CTTATTATTCTACCTAATTTCTTTATTTTAATGACTTAACTTTAAAATTAAGCACAACTAAAAATAAAAGTAAAAAGTTG ACATAGACAAAATGTTTAAATAATATAATCTCATTAAACAAGTGTACCACATAAATAATATGACGTGATACATTTGGTGT ATTGAATAATTTATC