>DTM_20_1_Mno length=2537;Class=DNA transposons;Order=TIR;superfamily=MuLE; TTGTTGGTTTATGGTATTTAGCTAGTTCCATTGTCTATCTTTTTCTCAAGATATATAACAGTCTTGCTTATAAAGGGATG ACATGTGCAGGTCACTTTAGTTTTCGTTTCAGCTAGGATAATGACGAGTTCTTTCTTGTAGTCGACGAAGTAACAAACTA TACAGTTATTAAGTTAATTGATCTGGCATGGACGTTGAATTGGTGGATGGTGGAGGCGAAAATAGGGGACGTTCTGTGGG AGAAAGCACTGAACTGAATGGAGGTGGAAAAAAACACGTGAATGAAAGTTCGACGGGAAGAGATCGTAGTAATCAAGAGG ATGATGGCAATTCTAAACCTCATGTGGGCATGGAGTTTGACACAGAAGATGCTGCCAAGATTTTCTATGATTCATATGCC AGACGTGTAGGTTTCAGCACTCATGTTGGTCAATTCAGTCGTAGTAAGCCTGATGGACCAATTGTAACTTGGGAGTTTGC TTGTTCTAGAGAGGTATTTAAAAGGAAAAATGTAGAAAGCTGCAATGCTATGCTAAGATTAGGGAGAAATGATGCAAATG GTTGGGTTGTGACCAAGTTTGTTGAGGACCACAACCATTCAATGACTAGTTCTGGTAAGGTTCATCACCTTCGACCTCGC AGACATTTTGCTGGTGCTACAAAGAACGCGGCTGATACATTGGATACTTCAAGTGATGTTTACGTTTCCGTGGATGGCAA TCATGTATCTCACGAACCTAACCGTGGAGTTAGGAGTGTCTCCCCTGTAGAATTCAATCGCCAAGCAAGGAATATTGGGC CAGTAAACTATATAAGGCCTTCTAGCCGAAAGAGAACTCTTGGAAGAGACGCACAGAATCTTCTAAACTATTTCAAAAAG ATGCAGGCTGAAAACCCAGGCTTCTTTTATGCAATACAGCTAGATGATGATAACCGCATGACTAATGTCTTTTGGGCTGA TGCACGATCAAGGGCAGCGTATAACTGCTTCGGTGATGCTGTAATATTTGACACAATGTATAGACCAAATCAATACCAGG TCCCATTTGCTCCTTTCACAGGTGTAAATAATCATGGTCAGATGGTATTGTTTGGTTGTGCGCTGCTTTTGGATGAGTCA GAGTCTTCGTTTACTTGGTTGTTTAGGACCTGGTTGTCTGCAATGAATGACCGCCCCCCTGTTTCTGTAACAACGGACCA AGATAGGGCCATACAGGTCGCAGTTGCTCATGTATTTCCAGAAACTCGTCATTGTATATGCAAGTGGCATATCTTGAGAG AAGGGCAGGAAAGATTGGCTCACATATATCTGGCTCATCCTTCATTCTACGGGGAGCTGTACAGCTGCGTGAACTTTTCA GAGACCATTGAGGATTTTGAATCATCATGGGCATCTCTCCTTGATAGATATGACCTCTGCAGAAATGAGTGGCTGCAGGC TGTATACAGTGCTCGAAAGCAGTGGGCCCCAGTTTATTTCCGTGGTACATTCTTTGCTGCACTTTCCTCAAGCCAAGGTG TTAGTTCTTTCTTCGATGGTTATGTGAATCAGCAGACCACCATACCACTATTTTTTAAACAGTATGAGAGAGTTCTTGAG CATTCGTTAGAAAAAGAAATAGAAGCTGATTATGACACAATTTGTACGACACCAGTGCTGAAGACGCCATCACCAATGGA GCAACAGGCAGCCAACCTTTACACGAAGAAAGTTTTTGCCAAGTTTCAAGAGGAACTAGTCGAAACTTTTGTGTATACTG CAAATAATATTGAAGGTGATGGGGTAGTGAGTAAGTACCGAGTTGCAAAATATGAACATGATGACAAAGCGTACATAGTC ACTTTAAATGTCTCAGAAGTGAGAGCAAATTGCAGCTGTCAGATGTTTGAGTATTCTGGTATTCTATGTAGACATATATT AACTGTGTTCACTGTAACAAACGTTCTTACCCTTCCTTCACATTATATATTGAAGCGTTGGACAAGGAATGCCAAAGCTG CAGTTGGACAGGATGAATCAAGTACAGATCCACAAGCTATTGAGACTCTTACCGTGCGCTTTAACAATTTATGTCGGGAA GCAATTAAATATGCAGAGGAAGGGGCAGTTTCTGTTGAGACCTATAATACAGCTATGGGCGCTTTGCGAGAGGGCGGGAA AAAAATTTCTGTTGTGAAGAAAAATGTTACTAAAGTCACACCACCTACTTCCCAGGGAAGTGGAAATAGTCAGGATGAAG GTAACAAGAGAGGGCATTTGCCAGCATTGGAAATGGTTTCCTCATTATGGCCTTGGCAAGAAGCAATGCCACACCATTTT AATCTTAATGATGTCGGTATTCCTGGTTCTAATCTGAATCAGCCCAACTCTGTGTCTATTCAACGCGACAATGGCCCTTC TGATAACACGGTAAGAAAATGAAAAATATTGTTTAGTTCTTTTGGGCACTTTATGGTGCTAAGATGTTTCGATAAAAGTT AGTATCTGGAGATTTGATGATTTTTAAATTTCTATGTAGGTGGTTCTTACTTGTTTT