>DTM_2_1_Mno length=2531;Class=DNA transposons;Order=TIR;superfamily=MuLE; CAAAAACTCTGTTGAGAATTTTTTTATTCATTCATGGCTACACTAGACATTAGCCAAAATAAAACACGTCCTTTAACAAT AAAAACGTTGCAAGTTGATAGTTGCAATATTGAGTCTATGGATGTTCACTTATATCTTTTCACAATTCTGTAATGGGAGC ACTATATACACTCTTGGTCTCCTTTATTTGCAGACTAAACCACTACACTAGTCCAAATTCCAACTAGAGCACCGGTACAG TATGGAGTGGCAAGATTTCTGTACCACTTTAGTCTTGACAAAAACGGCTTGGGATTTGCTACCAGAAGACTTACTTGGGA AAGAACTTGATACGGAAGAACTCTGGAATAACTTCTACAAGTTATACTCCAAACATATAGGCTTCAGCTACAGGAAAGAT AGTACAAGAAAGGAAAAGGACGGTGAACGTTGGGGTAGGCGGTGGTGCTGCTCGAGACAAGGTTTTAGGAGACGGAAGTG GTTGGAACTAGAACACCGTTCAAGAGCGGCGGCATCTGAAACACGTTGTGGGTGCGAAGCTAGTATTCGGGTAATAAGAA GCAAAACTACAAATAAGTGGGTATGTAGACATTTCAACCCTAACCACAACCACGAATGTGCGTCACCACAAGAAATCAGG TTTCTCAGATCAAATCGCAATGTCACTGATGACGTTGTTGCAAGGTGTGAGTCAATGAAACGGGCTGGCATGAAAAATGT TCAAATAATAGACTTTATCGCATTAGAATCGGGGGGACACGACAAGCTCCCTTTCCTTGAAAAGGACATCCATAACAAAC TAATGCGAGTGCGCAACGCAAAGGACCAACATCAAAACATCACGGACTCAGATGGCATGCTTGGTTACATTAGGTGCTTG GCGAGGAACCACGGCGAGGACTTTTACTGCGTCTACAATGCCGATGAAGAAAACAGATTGTGTAACATAATGTGGTCGGA CGGGGTTTCGATGAGAGATTACGCAGTCTTTGGCGATGTCGTGGCCTTCAACACAACATATAGGACTAACAAATACCACA AACCTTTGCTTTTGCTAGTTGGGGTAAACAACCACTGGAGGACAATAGTGTTTGGCATTGCTCTCCTTCTCGACGAAACA GTTGATACGTTTGTCTGGGTTCTACAGATGTTTCTCCAAGGAATGAATAATTGGAAGCCAAAAGTTGTCGTTACGGATGG TGACAATGCCATGAAGAATGCCATAGCGCAAGTCTTTCCAGAATCTAAGCACAGGCTATGCGGATGGCATCTAATGGAGA ACGTAGCAAACAATGTGAAGGATATAAACTTCAAGCGGGACTTCAAGGAAATTATGTACAGATACTACTCCAAACCTGAG TTTCTCGATAGGTGGCATTCTTTGATTCTGGCATACGAACTAGAGAACAACTACTAGGCAACATGTATGTTTGAAAAGGG GGAGAGCTGGGCCGAAACCTATCTGCGTGGCAATTTCTGTGCAGGCATGCGAACCACTCAACGTAGCGAGTCGATGAATA GAACAATCAGACAATTCCTCGACAGTACGAAGTCTCTCACGGACTTTGTATCTTTGGTTGACCACGCCATTAACAAGCTG CACCACAAAGATTTGCAGGATGACTTCTCCCCCCGACACAATATTCCTTCTTTGCGACATGCAGATATTTTAAACCCATA CTATCAACATGTTGCCTCTTTGTTCACGAGAAGAATTTATACAAAAAAGGTTTCTCACGAAATAAAGCTCATACATGCAT ACACTGTTAGGCAAGTTGATGAGATCGATGGGTATATAAATTTCTCAATCATCAAGTTCCCAAACGGAGACTCCGAGCAC AATGTTATACGTCGCATCTCTGACAGTCATCTAACGTGCAATTGCTTACTCTTCGAGACTGATGGATATCCGTGCAGACA CATATTTTCAGTTCTGAAGTTTCTAAACATAACCAGAATTCCAGATTCGCTTGTTTTGGCAAGGTGGGCTGTTCATGCAA AGGCCCAATTCCAAACCAGATATCAAAGTAATAACGAGGTCCCACAGGAGATATTGGAACTAACTAGGTTCGGAACCCTC AGTTCCGACTTCAACCAAGTAGCATACTATGCAACGAAAGTGGAGGATTTCTACCAACAAACAAGAACAGAACTTGCAAA TTTATGTTTAAAATTTAAGAGCTTGATGGAAAGGGAGCCACCTCTTGTGCAAGAAGAGTCTATTGATGAAATCAATCCGT TTGAAGTACTAAAAGATCCTATTGTTGTTCGAAACAAGGGAACGGCAAGGCGGCCGCAAGTGGGGCCTAGTGCTCAGGAG AATTGGGTTTGGAAAGATTAAGAAGGAAGTGTGCCCTGTGTAAGGGCCATGGGCACAACAAACAAACATGTCCATTAAAG AAAGACAAGGCCAAAACCATGCTGATTTGTTCAGAAGGGAACGACGACAGCACACACCCGACACAAATGTCTTTGGAAAA TATAAGCTCCTCCCAACAGTGTTACCGCCCTCACATGAATACCGAACACGA >DTM_2_2_Mno length=2531;Class=DNA transposons;Order=TIR;superfamily=MuLE; TTCGGTCTGTTTTTTGAGCAAGAATCACAGCGTTACCTTACCTTCACCATGATACGGACTCAATAAAACACATCCTTTAA CAATAAAAACATTAAAGTTGATAGTTGTAATATTGAGTCTATGCATGTTCACTTACAACAAAACAATTCTGTAATGGGAG CACTTAATTCACTCTCGCTCTCCTTTATTTGTAGAATAAACCACTACACTAGTCCAAATTCCAACTAGACTAACAATCAA AGATGGTGTGGCCAGATTTCTGTACCACTTTAGACTTGACTAAAACACCTTGGGATTTGCTACCAAAAAACTTACTTGGG AAGGACCTTGATACGGAAGAACTATGGGATAACTTCTACAAGTTATACTCGAAACATATAGGCTTCAGATACAGGAATGA TAGTACTAGAAAGGAAAAGGATGGTGATCGTTGCGGTAGATAGTGGTGTTGCTTGAGACAAGTTTTTAGGAGACGGAAGT GGTTGGAACTAGAACACCGCTCAAGAGCGGCGGCATCTGAAACATGTTGTGGGTACGAAGCTAGTATTCGGGTAGTAAGA AGCAAAACTACAAATAAGTGGGTATGTAGACATTTCAACCCTAACCACAACCACAAATGTGCGTCACCACAAGAAATCAG GTTTCTCAGATCAAACGCAATGTCACTGATGATGTTGTTGTAAGGTGTGAGTCAATGAAACGGCCTGGCATGAAAAATGT CCAAATAATAGACTTTATCGCATTAGAATTAGGGGGACACGACAAGCTCCCTTTCCTTGAAAATGACATCCATAATAAGC TAATGCGAGTGCGCAAGGCAAAGGACCAACATCAAAACATCATGGACTCGGATGGCATGATTGGTTACATTAGATGCTTA GCGAGGAACCATGGCGGGGACTTTTACTACATCTACAATGTCGATGAAGAAAACAGATTGTGTAACATAGTGTGGTCGGA CGGGGTTTCGAGGAGAGATTACGCGGTCTTTGGCAATGTCTTGGCCTTCGACACAACCTACAGGACTAACAAATACCACA AGCCTTTGCTTTTGCTAGTTGGGGTAAACAACCACTGGAGGACAACAGTGTTTGGCATTGCTCTCCTTGTCGACGAAACA GTTGATACGTTTGTCTGGTTTCTACAGATGTTTCTTCAAGGAATGAATAATAGGAAGCCAAAAGTTATCGTTACTGACGG TGACAATGCCATGAAGAATGGCATAGCGCAAATCTTTTCAGAATCTAAGCACAGGCTATGCGGATGGCATCTAATGGAGA ACGTAGCGAACAATGTGAAGGATATAAACTTCAAGCGGGACTTTAAGGAAATTATGTACGGATACTACTTCGAACCTGAG TTTCTCGATAGGTGGCATTCTTTGATTCTGGCATACGAACTGGAGAACAATTACTGGGCAACATGTATGTTTGAAAAAAA GGAGAGTTGGGTCGAAACTTATTTACGTGGCAATTTCTGTGTAGGCATGCGAACCACTCAACGTAGCGAGTCGATGAATA GAACAATCAGACAATTGCTCGACAGTACGAAGTCTCTCACGGACTTTATATCTTTGGTTGACCACGCCATTAACAAGCTG CGTCGTAAAGATTTGCAGGATGACTTCTCCACCTGACACAGTACTCCTTCTTTGCGACATGCAGATATTCTAAACCCATA CTATCAATACGCTGCTTCTTTGTTCACGAGAAGAATTTATACAAAAAAGGTCTCTCACGAAATAAAGCTCATACATGCAT ACATTGTTAGGCAAGTTGTTGAGATTGATGGGTATATAAATTTCTCAATCATCAAGTTCCCAACGGAGACTCGGAGCACA ATGTTATACGTCGCATCTCTGATGGTCATCTAACATGCAATTACTTACTCTTCGAGGCTGATGGATATCCGTGCAGACAC ATATTTTCAGTAATGAAGTTTATAAACATAACAAGAATTCCAGATTCACTTGTTATGTACAGGTGGGTTGTTCATGCAAA GGCCCAATTCCAAAGACGATATCAAACTAATAACGAGGTCCCACAGGAGATATTGGAACTAACTAGGTTCGGAACCCTCA GCTCCGACTTCAACCAAGTAGCATAATATGCAACGAAAGTGGAGGATTTCTACCAACAAACAAGAACAAAACTTAGAAAT TTATGTTTAAAATTTAAGAGCTTGATGGAAAGGAGCCACCTCTTGCGAGGCAACAAGAGTCTTTCGATGAAATCATTTTG TTTGAAGTACTAAAAGATCCTATTATTGTTCGAAACAAGGGAACGGCAAGGCGACCGCAAGTGGGGCCGAGTGCTCAGGA AGAATTGGGTTTGGAATGATTAAGAAGGAAGTGTGCCCTGTGTAAGGGCCATGGGCACAACAAACAAACATGTCCGTTAA AGAAAGACAAGGCCAAAACCATGCCGACTTGTTCAGAAGGGAACGACGACAGCACACACCCGACATAAATGTATTTGGAA AATATATGCTCTTCCCAACAGTGCTACCGCCTTCACATGAATACCGAACAC >DTM_2_3_Mno length=2531;Class=DNA transposons;Order=TIR;superfamily=MuLE; AAAAACTCTGTTGAGAATTTTTTTTATTCATTCATGGCCACACTAGACATTAGCCAAAATAAAACACGTCATTTAACAAT AAAAACGTTGCAAGTTGATAGTTGCAATATTGAGTCTATGGATGTTCACTTATATCTTTACACAATTCTGTAATGGGAGC ACTATATACACTCTTGGTCTCCTTTATGTGCAGACTAAACCACTACACTAGTCCAAATTCAAACTAGAGCACCGGTACAG TATGGAGTGGTAAGATTTCTGTACCACTTTAGTCTTGACAAAAACGGCTTGGGATTTGCTACCAGAAGACTTACTTGGGA AAGAACTTGATACGGAAGAACTCTGGGATAACTTCTACAAGTTATACTCCAAACATATAGGCTTCAGCTACAGGAAGGAT AGTACCAGAAAGGAAGAGGACGGTGAACGTTGGGGTAGATGGTGGTGCTGCTCGAGACAAGGTTTTAGGAGATGGAAGTG GTTGGAACTAGAACACCGTTCAAGAGCGGCGGCGTTTGAAACACGTTGTGGGTGCGAAGCTAGTATTCAGGTAATAAGAA GCAAAACTACAAATAAGTGGGTATGTAGACATTTCAACCCTAACCACAAGCACGAATGTGCGTCACCACAAGAAATCAGG TTTCTCAGATCAAATCGCAATGTCACTGATGACGTTGTTGCTAGGTGTGAGTCAATGAAACGGGCTGGCATGAAAAATGT TCAAATAATAGACTTTATCGCATTAGAATCGGGGGGACACGACAAGCTCCCTTTCCTTGAAAAGGACATCCATAACAAGC TAATGCGAGTGCGCAATGCAAAGGACCAACATCAAAACATCACGGACTCAGATGGCATGCTTGGTTACATTAGATGCTTG GCGAGGAACCACGGCGGGGACTTTTACTGCGTCTACAATGCCGATGAAGAAAACAGATTGTGTAACATAATGTGGTCGGA CGGGGTTTCGAGGAGAGATTACGCGGTCTTTGGCGATGTCGTGGCCTTCGACACAACATACAGGACTAACAAATACCACA AACCTTTGCTTTTGCTAGTTGGGGTAAACAACCACTGGATGACAACAGTGTTTGGCATTGCTCTCCTTCTCGACGAAACA GTTGATACGTTTGTCTGGGTTCTATAAATGTTTCTCCAAGGAATGAATAATAGGAAGCCAAAAGTTGTCGTTACTAACGG TGACAATGCCATGAAGAATGCCATAGCACAAGTCTTTCCAGAATCTAAGAACAGGCTATGCGGATGGCATCTAATGGAGA ACGTAGCGAACAATGTGAAGGATATAAACTTTAAGCGGGACTTCAAGGAAATTATGTACGGATACTACTCCGAACCTGAG TTTCTCGATAGGTGGCATTCTTTGATTCTGGCATATGAACTAGAGAACAACTACTGGGCAACATGTATGTTTGAAAAAAG GGAGAGCTGGGCTGAAACTTATCTGCCTGGCAATTTCTGTGCAGGCATGCGAACCACTCAATGTAGCGAGTCGATGAATA GAACAATCAAACAATTCCTCGACAGTACGAAGTCTCTCACGGACTTTGTATCTTTGGTTGACCACACCATTAACAAGCTG CGCCACAAAGATTTGCAGGATGACTTCTCCACCCGACACAGTATTCCTTCTTTGCGACATGCAGATATTCTAAACCCATA CTATCAACACGCTGCCTCTTTGTTTACGAGAAGAATTTATACAAAAAAGGTTTCTCACGAAATAAAGCTCATACATGCAT ACACTGTTAGGCAAGTTGATGAGATCGATGGGTATATAAATTTTTCAATCATCAAGTTCCCAAACGAAGACTCCGAACAC AATGTTATACGTCGTATCTCTGACAGTCATATAACGTGCAATTGCTTACTCTTCGAGACTGATGGATATCTGTGCAGACA CATATTTTCAGTTCTGAAGTTTCTAAACATAACCAGAATTCCAGATTCGCTTGTTCTGTCCAGGTGGGCTGTTCATGCAA AGGCCCAATTCCAAACCAGATATCAAAGTAATAACGAGGTCCCATAGAAGATATTGGAACTAACTAGGTTCGGAACCCTC AGTTCCAACTTCAACCAAGTAGCATACTATGCAATGAAAGTGGAGGATTTCTACCAACAAACACAGAGCTTGCAAATTTA TGTTTAAAATTTAAGAGCTTGATGGAAAGGGCGCCACCTCTTGTGCAAGAAGAGTCTATTGATGAAATCAATCCATTTGA AGTACTAAAAGATCCTATTGTTGTTCGAAACAAGGGAACGGCAAAGCGGCCGCAAGTGGGGCCTAGTGCTCAGGAAGAAT TAGGTTTGGAAAGATTAAGAAGGAAGTGTGCCCTGTGTAAGGGCCATGGGCACAACAAACAAACATGTCCATTAAAGAAA GACAAGGCCAAAACCATGCTGATTTGTTTAGAAGGGAACGACGACAGCACCCACCCGACACAAATGTCTTTGGAAAATAT AAGCTCCTCCCAACAGTGCTACCACCCTCACATGAATACCGAACACGAGGG >DTM_2_4_Mno length=2531;Class=DNA transposons;Order=TIR;superfamily=MuLE; TTCCTTATGTCCATTTTAAAGTTTAAAATTGTTTTCTCCATATAAACTCGTTGCAAATTTTTTGCTTGAATCATGGCTAC ACTATACATTAACCAAAATAAAACACGTCCTTTAACAATAAAAACGTTGAAGTTGATAGTTGCAATATTGAGTTTATGCA TATTCACTTACAAGAAAAATAATTCTGTAATGGGAGCACTTAATTCACTCTTGGTCTCCTTTATTTGCAGAATAAACCAC AACACTAGTCCAAATTCCAACTAGAGCAACAGTCAAAGATGGTGTGGCCAGATTTATGTACCACTTTAGACTTGACTAAA ACGCCTTGGGATTTGCTAACAGAAGACTTAATTGGGAAGGATAATACTCGAAACATATAGGCTTCAGCTGCAGGAAGGAT AATACTAGAAAGGAAAAGGACGGTGATCGTTGTGGTAGACGGTGGTGCTGCTCGAGACAAGGTTTTAGGAGACGGAAGTG GTTGGAACTAGAACACCGATCAAGAGCGGCGGCATCTGAAATACGTTGTGGGTGCGAAGCTAGTATTCGGGTAGTAAGAA GCAAAACTACACATAAATGGGTATGTAGACATTTCAACCCTAACCACAACCACGAATGTTCGTCACCACAAGAAATCAGG TTTCTCAGATTAAATCACAATGTCATTGATGATGTTGTTGCAAGGTGTGAGTCAATGAAACAGGCTGGCATGAAAAATGT CCAAATAATAGACTTTATCGCATTAGAATTGGGGGGACACGACAAGCTCCCTTTCCTTGAAAAGAGCATCCATAACAAGC TAATGCGAGTGCGCAAGGTAAAGGACCAACATCAAAACATCACAGACTCAGATGGCATGATTGGTTACATTAGATGCTTG GTGAGGAACCACGGCGGGGACTTTTACTGCGTTTACAATGCAGATGAAGAAAACAGATTATGTAACATAATGTGGTCGGA CGGGGTTTCGAGGAGAGATTACGCGGTCTTTGGAGATGTCTTGGCCTTCGACACAACCTATAAGACTAACAAATACCACA AACCTTTGCTTTTGCTAGTAGGGGTAAACAACCACTGGAGGACAACAGTGTTTGGCATTGCTCTCCTTGTCGACGAAACG AAAGATACGTTTGTCTGGGTTCTACAGATGTTTCTTCAAGGAATGAATAATAGGAAGCCAAAAGTTGTCGTTACTGATGG TGACAATGCCATGAAGAATGCCATAGTGCAAGTCTTTCCGGAATCTAAGCATAGGTTATGCGGATGGCATCTAATGGAGA ACGTAGCGAACAATGTGAAGGATATAAACTTCAAGCAAGACTTCAAGGAAATTATGTACGGATACTACTCCGAAATTGAG TTTCTCGATAGGTGGCATTCTTTGATTCTGGCATACGAACTGGAGAACAACTATTGGGCAACATGTATGTTTGAAAAAAG GGAGAGCTGGGCCAAAACCTATTTGCATGGCAATTTCTGTGCAGGCATGCAAACCACTCAATGTAGTGAGTCGATGAATA GAACAATCAGACAATTGTTCGACAGTATGAAGTCTCTCACAGACTTTGTATCTTTGGTTGACCACACCATTACCAAGCTG CGCCACAAAGATTTGTAGGATGACTTCTCCACCTGACACGGTACTCCTTCTTTATGACATGCAGATATTCTAAACCCATA CTATCAACACACTGCCTCTTTGTTCACGAGAAGAATTTATACAAAAAAGGTATCTCACGAAATAAAGCTCATACATGCAT ACATTGTTAGGTAAGTTGATGAGATCGATGGGTATATAAATTTCTCAATCATTAAGTTCCCAAAAGGAGACTCGGAGCAC AATGTTATACATCGCATCTCTGACGGTCATCTAACATGCAATTGCTTACTCTTCGAGACTGATGGATATCCGTGCAGACA CATATTTTCAATTTTGAAGTTTTTAAACATAACAAGAATTCCAGATTCGCTTGTTCTGTCTAGGTGGGCTGTTCATGCAA AGGCCCAATTCCAAACACGATATCAAAATAATAATGAGGTCCCACAAGGGATATTGGAACTAACTAGGTTTGAAACCCTC AGCTCCGACTTCAACCAAGTAGCATACTATGCAACGAAAGTGGAGGATTTCTACCAACAAACAAGAACAGAACTTGCAAA TTTATGTTTAAAATTTAAGAGCGTGATGGAAAGAGAGCCACCTCTTGCGAGGCAACAAGAGTCTATTGATGAAATCAATC CATTTGAAGTACTAAAAGATCCTATTGTTGTTCGAAACAAGGGAACGGCAAGGCGGCCACAAGTGGGGCCGAGTGCTCAG GAAGAATTGGGTTTGGGAAGATTAAGAAGGAAGTGTGCCCTGTGTAAGGGCCATGGGCACAATAAACAAACATGTCAATT AAAGAAAGACAAGGCTAAAACCATACTGACTTGTTCAGAAAGGAATGACGACAGCACACACCCGACACAAATGTCTTTAG AAAATATATGCTCCTCCCAACAGTGCTACCGCCCTCACATGAATACCGAAC >DTM_2_5_Mno length=2529;Class=DNA transposons;Order=TIR;superfamily=MuLE; CCATTTTAAAGTTTAAAATCGTTTTCTCCGCATAAACTCTTTGCAAATTGTTTGCTTCATTCATGGCTACACTACACATT AACCAAAATAAAATACGGCCCTTAACAATAAAAACGTTGAAGTTGATAGTTGCAATATTGAGTCTATGCATGTTCACTTA CAACAAAAATAATTATGTAATGGGAGCACTTAATTCACTCTTGGTCTCCTTTATTTGCAGAATAGACCACAACAGTCAAA GATGGTGTGGCCAGATTTCTCTACCACTTTAGACTTGACTAAAACGCCTTGGGATTTGCTACCAGAAGACTTACTTGGGA TGGAACTTGATATGGAATAACTAAGGGATAACTTCTACAAGTTATACTCGAAACATATAGGCTTCAGTTACAGGAAGGAT AGTACTAGAAAGGAAAAGGATGGTGATCGTTGCGATAGACGGTGGTGCTGCTCGAGACAGGGTTTTAGGAGATGGAAGTG GTTGGAACTAGAACACCGCTCAAGAGCGGCGGCGTCTGAAACACATTGTGGGTGCGAAGCTAGTATTCGGGTAGTAAGAA GCAAAACTACAAATAAGTGGGTATGTAGACATTTCAACCCTAACCATAACCACGAATGTGCGTCACCACAAGAAATTAAA TTTCTCAGATCAAATCATAATCTCACTGATGATGTTGTTGCAAGGTGTGAGTCAATGAAATTGGCTGGCATGAAAAATGT CCAAATAATAGACTTTATTGCCTTAGAATTGGGGGGACACGACAAGCTCCCTTTCCTTGAAAAGGACATCCATAATAAGC TAATGCGAGTGCGTATGGCAAAGGACCAACATTAAAACATCACAGACTCAGATGGCATGATTGGTTACATTAGATGCTTG GCGAGGAACCATGGCGAGGACTTTTACTACGTCTACAATGCAGATGAAGAAAATAGATTGTATAACATAATGTGGTCGGA CGGGGTTTCGAGGATAGATTACGCGGTCTTTGGTAATGTCTTGGCCCTCGACACAACCTACAGGACTAACAAATACCACA AGCCTTTGCTTTTGCTAGTTGGTGTGAACAACCACTGGAGGACAACAGTGTTTGACAGCTCTCCTTGTTGACGAAACAGT TGATACATTTGTATGGGTTCTACAGATGTTTCTTCAAGGAATGAATAATAGGAAGCCAAAAGTTGTCGTTACTGACGGTG ACAATGCCATGAAGAATGCCATAACGCAAGTCTTTCCGGAATCTAAGCACAGGCTATGCGGATGGCATCTAATGGAGAAC GTAGCGAATAATGTGAAGGATATAAACTTCAAGTGGGACTTCAAGGAAATTATGTACGGATACTACTCCGAACCTGAGTT TCTCGATATGTGGCATTCTTTGATTCTAGCATACGAACTGGAGAACAACTACTGGGCAACATGTATGTTTGAAAAAAGGG AGAGCTGGGCCGAAACCTATTTGCGTGGCAACTTCTGTGCAGGCATGCGAACCACTCAACATAGCGAGTCGATGAATAGA ATAATCAGACAATTGGTCGACAGTACGAAGTCTCTCACGGACTTTGTATCTTTGGTTGACCACGCCATTAACAAGCTGCG CCACAAAGATTTGCAGGATGACTTCTCCACCAGACACAGTACTCCTTCTTTACGACATGCATATATTCTAAACCCATACT ATCAACACGCTGCCTCTTTATTCACAAGAAGAATTTATACGAAAAAGGTCTCTCATGAAATAAAGCTCATACATGCATAC ACTGTTAGGCAAGTTGATGAGATAGATAGGTATATAAATTTCTCAATCATCAAGTTTCCAAACATAGACTCAGAGCACAA TGTTATACTCGCATCTCTGACGGTCATCTAACATGCAATTGCTTACTCTTCGAGACTGATGGATATCCATGCAGACACAT ATTTTCAGTTATGAAGTTTTTAAACATAACAAGAATTCCAGATTCGCTTGTTCTGTCCAGGTGGGCTGTTCATGCAAAGG CCCAATTCCAAACACGATATCAAACTAATAACGAGGTCCCACAGGAGATATTAGAACTAACTAGGTCCTACAGGGATCCA CCTCTTGTGAGGCAACAAGAGTCTATTGATGAAATCAATCCGTTTGAAGTATTGAAAGATCCTATTGTTGTTCAAAACAA GGGAACGGTAAGGCGGCCGCAAGTAGGGCCGAGTGCTCAGGAAGAATTGGGTTTGGAAAGATTAAAAAGGAAGTGTGCCA TGTGTAAGGGCCATGGGCACAACAAACAAACATGTCCGTTAAAGAAAGACAAGGCCAAAACTATGCTGACTTGTTCAGAA GGGAACGACGACAGCACACACCCGACACAAATGTCTTTGTAAAATATATGCTCCTCCCAATAGTGCTACCGCCCTCACAT GAATACCAAACACGAGGGATTTACTATCTCCTTTGGACAACAATCCGATTCACTACTTAGTACATCCAAAAGTAGGATGC TTATCCTTTGAAAGGCAAATAACATATATCAAGCTATATACTTAACACG >DTM_2_6_Mno length=2524;Class=DNA transposons;Order=TIR;superfamily=MuLE; CATAATGTACATTGTCAAATCCTGCATTATTATGGGTTTACATTTCTACCGATTAATATTATATACATCCTTTAACAAAC ACCGTTGAAGTTGATAGTTTTAATATTGAGTCTATGCATGTTCACTTACAATAAAAGCAATTATGTAATGGGAGCACTTA ATCTTCTCTTGGTTTCCTTTATTTGCAAAAGAGACTACTACACTAGTCCAAATTCCAACTAGAGCAACAGTCAAAGATGA AGTGGCTAGATTTCTGTACCGTTTTATACTTGACTAAAACGGCTTAGAATTTACTACCGGAAGACTTACTTAGGAAGGAA CTTGATATAGAAGAACTACGGGATAACTTCTACAAGTTATACTCGAAACATATAGGCTTCAGCTACAAGAAGGATAATAC TAGAAAGGAAAAGGACGGTGATCGTTGGGGTAGACGGTGGTGCTGCTCGAAATAAGGTTTTAGGAGACATAAGTCGTTGG AACTAGAACACCGCTCAAGAGCGGTGACGTTTGAAACACGTTGTGGGTGCGAAGGTAGTATTCGGGTAATAAGAAGTAAA ACTACAAATTAGTGGGTATGTAGACATTTCACCCCTAACCACAACCACGAATGTGCGTCACCATAAGAAATCAGGTTTCT CAGATCAAATCGTAATGTCACTGATGACGTTGTTGCAAGGTGTGAGTCAATGAAACGGGCTGGCATGAAAAATGTATAAA TAATAAACTTTATCGCATTGGAATTGGGGGGACACGACAAGCTCCCTTTCCTTGAAAATGACATCCATAACAAGCTAATG CGAGTGCGCAAGGTAAAGGACCAACATCAAAACATCACAGACACAGATAGCATGCTTGGTTACATTAGATGCTTGGCGAG GAACCACGGCGGGGACTTTTATTGCGTCTACAATGCCGATGAAGAAAATAGATTGTGTAACATAATGTGGTCGGACGGGG TTCGAGGAGAGATTACGCGGTCTTTGGCGATGTCTTGGACTTCGACACAACCTACATAACTAACAAATACCACAAGCCTT TGCTTTTGCTAGTTGGGGTAAACAACTACTGGAGGACAACAGTGTTTGGCATTGCTCTCCTTACCGACGAAACAGTTGAT ACGTTTGTCTAGGTTCTACAAATGTTTCTTCAAGGAATGAATAATAGGAAGCCAAAAGTTGCCGTTATCAACGGTGACAA TGCCATGAAGAATGCCATAGCGCAAGTCTTTCTGGAATCTAAGCACATGCTATGCGGATGGCATCTAATGGAGAACACAG CGAACAATGTGAAGAATATAAACTTTAAGCGGGACTTTAAGAAAATTATGTACGGATACTCTCCGAACCTGAGTTTCTTG ATAGGTGGCAATCTTTGATTCTGGCATACGAACTGGAGAGCAACTACTGGGTAACATATATGTTTGAAAAAAGGGAGAGT TGGGCCGAAACCTATTTGCATGGCAATTTCTGTCCAGGCATGCGAACCATTCAACATAGCGAGTCGATGAATAGAACAAT TAGACAATTCCTCGACAGTATGAAGTCTCTCACGAACTTTGTATCTTTAGTTGACCACGCCATTAACAAGCTACGCCACA AAGATTTGCAGGATGAATTCTCCACCCGATACAGTACTCCTTCTTTACGACATGCAATAATCTAAACTCATACTATAAAC ATATTGCCTCTTTGTTCACGAGAAGAATTTATACAAAAAAGGTATCTCATGAAATAAGGCTCATACATGCATACACTGTC AGGCAAGTTAATGCAATCGATGGGTATATAAATTTCTTAATCATCAAGTTCCCAAACGGAGACTCGGAGCACAATGTTAT ATGTCACATCTTTGACGGTCATCTAACGTGCAATTGCTTACTCTTCGAGACTAATGGATATTTGTGCAGACACATATTTT CAGTTCTGAAGTTTCTAAACATAACAAGAATTCCAGATTCGTTTGTTATGTCCAGGTGGACTGTTCATGCAAAGGCCCAA TTCCAAACCCGATATCAAACTAATAACGAGGTCCCACAGGAGATATTGGAACTAACTAGGTTCAGAACCGTCAGTTCCGA CTTCAACCAAGTAGCATACTATGCAACGAAAGTGGATGATTTCTACCAACAAACAAGAACAGAACTTGCAAATTTTTGTT TAAAAGTTAAGAGCTTGATGGAAAGGGAGCCATCTCTTGCGAGCCAACAAGAGTCTATTGATGAAATCATCCGACACAAA TGTCTTTGGAAAATATATGCTCCTCCCAACAGTGCTACCACCCTCACATGAATACCGAACATGAGGGATTTACTATCTCC TTCAGACAACAATCCGATTCACATACTTACTACATCCAAAAGTAGGACGCTTCTCCTTTGAAAGGCAAATAACATATATC CAGCTATATACGTAAGACGTATATGTTTTGTCTTTACTAAGCATTCCTAATGAAATAACATTTTTATTTGTTTTAACACT TCAACATTATCCAGCATATTACGATGCTTTATTAGTCATTTTCT