>DTM_2N_1_Mno length=179;Class=DNA transposons;Order=MITE;superfamily=MITE; GGGAGTTTCTCTGGTAGTCCGCCCTACCGGTAGTCTCAGTTTTTGACCGTTAGATCTGGTCAAAATCACATCAGATTAAA AAAATATGCAGAACAGACAGATTTTGATACAAATCTGACGGCTGAAAAGTAAAAAACTACCGATAGTCTATTTTTACAAG GACTACCAGAGAAAGTCCC >DTM_2N_2_Mno length=146;Class=DNA transposons;Order=MITE;superfamily=MITE; ACTACTGGTAGTTTCTTACTTTTCAGCCATTAGATCTATATCAAAATCTGTCTGTTCTGCATATTTTTTTAATCTAATGT GATTTTAACTAGATCTAACGGTTAAAAACTGAGACTACCGGTAGGGTGGACTACTAGAGAAACTCT >DTM_2N_3_Mno length=187;Class=DNA transposons;Order=MITE;superfamily=MITE; TTGGGACTTTCTCCAGTAGGTCTCTCTACTAGTAGTATCAGTTTTTGACCGTTAAATCTAGTTAAAATCACATCAAATTA AAAAAATATGCAGAACAGACAATTTTTAATACAAATCTGACGATTGAAAAGTAAAGAACTATCAGTAGTTCATTTTTTCT GATCCTACTAGAGAAACTCCCTTATAT >DTM_2N_4_Mno length=125;Class=DNA transposons;Order=MITE;superfamily=MITE; TACCGATAGTTTTAATTTTTAACCGTTAGATCTGATCAAAATCACATCAAATTAAAAAAATATGCAGAACAAACAGATTT TGATACAGATCTGACGGCTGAAAAATAAGAAACTACCGGTAGTCT