>DTM_19_1_Mno length=2543;Class=DNA transposons;Order=TIR;superfamily=MuLE; CCGGAAAAGAATCTAGAAGAAAGTAAGATCAAATGCGAAATTCGTAGATAGAAATCTTCGGAAATAATGCTAATTTCATT TTTCCCCAAATCAGTTAATTTTATATATATATATATATATATATATATAAAATCTGTTGCTGGGTCGCCGCATTTCAATG GTTTGGCATTTTGTTTTAAAAAAAAAATCGTGTTTTCAGATGGAAGAAGTGTGTCTGAATAGCGAGCCGGTTTTCGAAGA AGTTGATGATGAGTACGAGGTTGATGGAGATTGCCCCGTGGCTGAACATGATTACCAAATTGGGGAAACACAAAGGAAGA AGCATGCCCCACTCCCAACTGTGGGTTTGGAGTTCGATTCCTTTGAAGAGGCTTATGATTTCTACAATGTTTACGGAAAA GAGCAGGGGTTTGGAATCAGAGTGAGCAACTCGTGGTTCAGGTCGAAGAGGAAAGAGCGGTACAGGGCGAAATTGAGTTG CAGCAGTGCAGGGTTCAAGAAGAAGAGTGAGGCCAACAACCCGAGGCCCGAAACAAGGACAGGTTGCTCCGCCATGATTG TGATCAGGCTGGTGGACTCACAAAGGTGGAGAATAGTTGAAGTGGAGCTTGAACATAACCATCAAGTCAGTCCACAGATC AAGAGGTTTTACAAGTCTCATAAGAGGATGATTCTTGCTGCTAAAAAGGCACAACTTCCTGCACAGCCTGTGACAGAAGT GCATACCATCAAGCTCTACCGAACAGCTGTTATGGATTCTGCGTGTAATGGGTACTCGTCGGGTTTTCAGGAAAGGGAGG GTATGAGTGGGGTGGACCACTCCAAGCATTTGGAGCTCAAAGAAGGAGATGCTCATGCGGTTTACAACTACTTTTGTCGG ATGAAGTTGACGAACCCGAATTTCTTTTACTTGATGGATGTGGATGATGACGGGCGTTTAAGGAATGTATTTTGGGCTGA TGCCAGGTCCAGGGCTGCTTATGGTTACTTCTGCGACACGGTTGCTATAGACACGACATGCTTGGCAAACAAATATGAGA TCCCACTGATATCGTTTGTTGGTGTGAATAACCACGGGCAATCCATATTGCTGGGATGCGGCTTTCTTGGGCATGAGTCA GTGGAGTATTTCATTTGGATGCTCAGGGCATGGTTAAAATGCATGCTAGAGTGCCCTCCACTAGTTGTTATTACCGATCA GTGTAAACCTTTGCAAACTGCAGTTTCCGAGGTTTTCCAAAATGCGCGTCATTGTTATTGCCCGTGGTATATAATGCAGC GAGTTCCAGAGAAGTTGGGAGGACTGAAGGGATACGAAGCAATCAAAAGACAGTTGAATAAAGCAGTTTATAGTTCCTTG AAAATTGCCGAGTTCGAAACTTCTTGGGCTGACATGATCAAGCGGCACGGACTTGGAGATAATAAATGGCTTCAGACACT GTATGAAGAACGACAAATGTGGGTTCCGGTTTACTTGAAGGATGTATTTTTTGCAGGAATGATCCCTATCCATGAAAATG AAGGCTTGACTTCTTTTTTTGATGGTTATGTACACAAGCACGCATCATTTAAGGAATTTGTTGATAAGTACGATCTAGCT CTGCATAGGAAGCGAATGAGGGAGGCAACATCGGATCTGGACTCGAGAAATTCGAGCTATGAATTGAAAACGAGATGCAA CTTTGAGGTGCAGCTGTCTAAAGTATACACAAAAGAGATCTTCAAGAGGTTCCAGTCTGAAGTTGAGGGGATGTACTCCT GTTTCAACACAAGGCAGGTCAATGTCAATGGGGCAATAGTCACGTACATTGTCAAAGAAAGAGTTGAAGTTGGGGGAAGC GAAAAGGAAGTTAAGTACCATGAGGTTTTGTATGAGACAACACAAGTGGATATAAGATGCATTTGCAGTTTGTTCAATTA CAAAGGCTATCTTTGCAGGCATGCTTTGAATGTCCTTAATTACAACGGCGTCGAGGAAATCCCGTCGCGGTATATTTTGC CTCGGTGGAGTAGAGATTTTAAGTGTAGGTATCTTCTAAATCACGGCTCCAGTGATTCCATTGACATGTACAGCCCGTTG TACTGGTATAATCATCTAAATAAGCTTGCCCTTCCGGTTGTGGAAGAAGGGGCACAATCTCAAGAACGTTATAAGACCGC GTTGCAAGAATTAGACGCGCTGTTAAAGAAGTTTAATATTGTAGAGGATAACTTAGTGTAACACAGGATAAATATTTTTT AACTTATCAACTTTGGAAGGAATGCCAAGAAGTTTCTTTCCACAAATGACTTTATTTGGTAAATATGCTTGCTCTCTCTC TCTCTCACATAGAGAATAAAAGTTGTAGCATTTTTTAAATGAATATCTTTTATGAGATTTTTGTTACGAACTGGTGTCCT TTTGGGATTGACAATATAGTGAATATCGACCTCTTTTTTGAAGCATATAGAATCAAATTCCAAGCACGCGTGTACTACAT TACAATTTCCCTGCATATTTAACATTCCATGTTGAAAAGCGGACCAACCTTACCTAACTTGAG