>DTM_13_1_Mno length=3232;Class=DNA transposons;Order=TIR;superfamily=MuLE; CTCATTCGAAATTCGAATATCTACATATTGATTACGCCTCGCCTCGATTAAGACAAAATGCGCATCTGATTCCTGATTCC GCCTTTTAGAACTATGATTTTCTTTTTGTTTGTTTAGTACTGGAGATGGGGTCTTAGGTCAATGTTAATCAGATTATGAG GGAAGCATAATGTCTGATGAAGCCGGACAGATGCTAGTGGTTTATGATGATCCTTCAGACCATCGATCGTTGTCGATAGA TGATACGAGCAGCACTGAGGAATCGCTCGATGAAACTAGGCTTTCCTTAGAAACTACGAATGATACAATTCCATACATTG GGCAAAGATTTGCCACTCATGATGCTGCTTATGAATTCTATAGTGAATTCGCAAAGCGATGTGGATTCTCAATCCGGAGA CATCGTACGGAGGGAAAAGTTGGAGTTGGAAAAGGACTCACGCGGCGTTACTTTGTTTGCCACCGAGCTGGCAATACCCC TATCAAAAACTCCAATGAAAGCAAACCTCAAAGGAATAGAAAATCCTCCCGATGCGGGTGTCAAGCTTACATGCGTATTA GCAAGGCAGCAGAGTTAGGAGGGCCGGAATGGCGAGTCACGGGTTTTGCAAACCATCATAACCATGAACTGTTGGAGCCA AACCAAGTTCGTTTCCTTCCCGCGTATAGAACCATCTCAGAGTCAGATAAGAGTCGAATCCTTATGTTTGCTAAAACAGG AATGTCAGTGCAACAAATGATGAGGCTTATGGAGCTTGAGAAATGCGTGGAACCAGGATATCTACCGTTCACTGAGAAGG ATGTGAGGAATCTGCTACAGTCATTCAGGAAGCTAGATCCTGAAGAGGAGAGCATCGACTTATTGAGAATGTGCAAAAAC ATTAAGGAGAAAGATCCCAACTTCAGATTTGAGTACACCCTTGATTCAAACAACCGACTTGAGAACATTGCTTGGTCATA TGCATCATCACTCCAGTCGTATGACATATTTGGCGACACACTGGTGTTTGATACGACTCATCGATTGACTGCATTTGACA TGCCACTTGGTATATGGGTTGGAATGAATAATTATGGTATGCCTTGCTTCTTTGGCTGCGCGCTTCTACGAGAAGAAAAT TCGAGGTCGTTTTCATGGGCAGTGAAGGTAATAGTGAAAATACATTACCCTTTTTACGTCTCTTTCAATTAATCTTATAT TGCACATATGTTTGTATGTAGTATAGTATCTCTGTATATACATGCCCTTTCTATGTCCAATTAATTTTATCTTGCACATA AGGGTGCATGAAGTGTTGCTTTTTAATTGATTCATTCCTATGGCAATGCTGGGCCCAGTTGGGGAATGGGACAGAAAAAT CATGAGTTATGAAAATGAATGGCTGGGTAATTGCCTGTTACAATTTATCAAAAAAAAAAAAAAAAAAAAACTGTTGCTAG AGATCTTTAAAGTGGCACATAACTGTTAAGGTTTATGATCATGCACGAAAAGAAGCGGCCTAATTGACTGAATCTTAAGT GTTGGACTTGTAATGTATGTCTCAAAAGTAAAATGATTCGAGTATATATTGTTGATTGATGTAGTTGACTCCTGTGAATT GCTGACCTTTTTTTCTCTTTTACCCAATTAGTGAATGTGGATGAACACCCCCTCTTATATAGCCATGACTTTTTTGTTCA TTGCTTAAAATTTTCCAATTTCACCAACAAAATGGAACTTTGTTTTCAAAGTGTGTGGATGGAAATTCACACATGTTCAC ACATGCACATACATGTTTACATTTTAAAAGTTTTGGTGACACATCTATTCTCTCTTTTTTGTTCATATGGAAGGCATTCT TAGGGTTCATGAATGGAAAGGCCCCTCAGACGATACTCACTGACCAAAATATGTGTCTTAAAGAGGCAATAAGCATGGAA ATGCCAACCACTAAACATGCTCTTTGCATATGGATGATTGTGGCAAAATTTCCTTCATGGTTTAATGCAGTTCTAGGGGA ACGCTACAATGAGTGGAAAGGAGAGTTTTATCGACTTTATAATCTGGAGTCGATACAGGATTTTGAGCTAGGGTGGAGAG ACATGGTAAATTCTTTTGGGCTTCACACAAACAGGCATATTATCAACTTATATGGCTTACGCTCACTTTGGGCATTACCT TTCTTGAGAAGCTACTTTTTTGCTGGAATGACTACAATTGGCCAGTCGAAGTCCATTAACGCTTTTATCCAAAGATTCTT GAGTGCACAGACCAGGCTTGCCCACTTTGTAGAACAAGTGTGTTCTTTACCCCTTGCTTCTTTTCAGCTCTGTTTTATTT TTCATGTTTATAGCATATTCTATTTGTTACAATTCAGTTTTTGCTCCGACATTTTGTATCCCCATCTCCTACGTATTGTT TATTGAACATAAAGAGCTAGGATATGAACTGCTTTCGGGTTAGGACCAAGGTTCATGAGGATATCAAGATATGAAATATT TGTTGTTAATTATGTATATACGCCATATAGGATATTCTGTAGGTCCAGATAGAAAGATGTTTGAAAATTTATAGCTGGTC GCAGTCTTTTCGTTGCAAGCCAGAAAACACCACAGGCATAGAAAATATGTTGAATTATGGTGTGCACGAGAGACATTTAT GAGATTGGAATTCTGCAACAAAAGAGGATTTGATAGCACGTAAGTTTGAAAGATTGTAGAATGCTTCGTTTTCGCCATTC TAGGATGAGCCTGGACTTGAAGAGAAGAACATGGACTTGTTTCCACATGGCCTGACTGCTATTTGACTTGTAACATTATT ACTTTTGATTTTCTCTCATATAGTTATCACTCATTCAATTGTTGATCCCCAAAATGATTTTAAGTGAACCTGTGAATGGT TTAGAACAAATCACAACAAACCCATGAGAAGATGGTATAATAGCAGATTGCCTATTGTATTAAGGGAGATTAGTTTGATA AAAGGATTGATATATATATATATATATATATATTTATTGAAAAAAGGAAGCTTAAATTACGTTGTAGCTGGCTTTGTGTT CATTTATTTGTTTTGCACAAGCAGGTAGCTGTTGCTGTTGATTTCAAAGATCAAGCCGGCGAACAACAAACAATGCAACA GAATCTCCAAAATATATGCCTGAAAACAGGGGCCCCCATGGAATCACATGCTGCCTCAATTCTAACTCCGTTTGCCTTCT CTAAGCTCCAAGAACAACTTGTTTTGGCCGCC