>DTM_1N_1_Mno length=193;Class=DNA transposons;Order=MITE;superfamily=MITE; TAAGAGAAATGCTAGCATCACTCTTTCTGTCACTCTTTTTGTCACTTTCTGCATTCACTGTTTGACACGTGGACTCCACT AACATGATATATTATTATTTAAACAGAAAATGAGATAGTAGAGTCCACGTGTCAAACAGTGAATGCAGAAAGTGACAAAG AGAGTGACAAAAGAGTGACGCTAGCATTTCTCT >DTM_1N_2_Mno length=155;Class=DNA transposons;Order=MITE;superfamily=MITE; GAAATGCTAGTTGTCACTCTTTTTGTCACTTTCTGTATTCATTGTTTGACATGTGGACTCTACTATCTCATTTTCTATTT AAATAATAATATATCATGTTAGTGGAGTCCACGTGTCAAACAGTGAATGCAGAAAGTGACAAAAATAGAAAGAGT >DTM_1N_3_Mno length=154;Class=DNA transposons;Order=MITE;superfamily=MITE; AACATCACTCTTTCTGTCACTCTTTTTATCACTTTTTACATTCATTGTTTGACACGTGAACTCTATTAACATGATATATT ATTATTTAAACAGAAAATGAGATAGTAGAATTCACGTGTCAAACAGTAAATGCAGAAAGTGACAGAAAGAGTGA >DTM_1N_4_Mno length=140;Class=DNA transposons;Order=MITE;superfamily=MITE; TCACTCTTTTTATCACTCTCTACATTTATTATTTGACATGTGGACTCTACTATCTCATTTTCTATTTAAATAATAATATA TCATGTTAGTGGAGTCCACGTGTCAAACAGTGAATGCAGAGAGTGACAAAAAGAGTGATG >DTM_1N_5_Mno length=107;Class=DNA transposons;Order=MITE;superfamily=MITE; ACTCTCTGCATTCACTATTTGACACGTGAACTCTACTAACATGATATATTATTATTTAAACAGAAAATGAGATAGTAGAG TCCACGTGTCAAACAATAAATACAGAG >DTM_1N_6_Mno length=165;Class=DNA transposons;Order=MITE;superfamily=MITE; TCTTTTTGTCACTCTCTTTTATTATTTGACACGTGAACTCCACTAACATAATATATTATTATTTAAACAGAAAATAAAAT ATGATCATATGTCAAACAGTGAAAAATAAGTTAGTAGAGTTCACGTGTCAAACAATGAATGCAGAAAGTGACAGAAAGAG TGATG