>DTH_9_1_Mno length=2517;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TTATAGTTGACCACGGATTAGTGATTTCGTTAGTCTTCGTTTGAGTGTTTCATTCTGTTGTGATGGGTTGAGATGTAAAA CCCTGGATTTGAGTTTTCTAATTAACTTGTTAGTGTTCATTTGTGTGTTTTCGTTACTCTTATTTCGTATGAGACTATAC TATTATTTTAATTTGAGTATAAGACTGTGTACCCCGGATTTCTGTTTATGCAATGGAAAGTGATTGTCCCTCATTTTATT TCCCCATTTTTATTACTAGCATTTCATGCATGCTTGACCCCACTTTATCATCATAGAGACATTATTGGATTATGTTGTAA TCTTTATATGATATTACCAAAGTAGGTTAAACCGTGAAGCTTTCAAGATCCAGGAAGAAGGATCCGGGCATGCAAATGAC GAGCACCAAAGAAGGGCATCTGCTAGACGACGACGACAGTTTATGGCTGCAACCGGAGCTGCACTAGCCACTGCCGCGTA TTTGGATATTGACACAGTACCAAGGCTTGTGCACATTTCTTCTTTGAGGGGTCTCGATAAGGTAAATGAGTTGTTAGCAA ACAATAATGAAGCTGCTATGTTTAACAAGGTGCGTATGGGACCACGTTGTTTTATGGTTCTTTGTGACATACTAACTGAG AGACGTTTGTTACGACCCTCGTACAACATGAATATACCAAAACAATTATTTGTGTTTTTAACAATTGCTTGCCAAAGTCA AACTAACTGTGAAGTGCAAGACATATGGCAACATTCTGGGGAGACAATTTCACGGCGGTTTACTGATGTCCTCGACGATA TATGTGCACTATACGTTGATTTTATTAAACCCCCTAACTATGAGAAAGTGCATGTTTTTTTACGTCGGAATCGGTAAAGA TATGGTACATGGTTTGACGTAAGTTCTCTAGCTCTTTTACCCAGGTCTTGTGTTAGTCACTGTTTCAATTGTTTTGACTT ATAATATCTACAATCCAATATCATTGTTCAGGATTGTGTAGGCGCGATTGACGAAACTCATATACTTTGTACACCGATTG GAGTTCCAAATCCTACGGCGTACCGCAATAGGAAGGGTGTGAACTCCCAAAACATATTGGCAGCCTACTCGTTCGATGTG AAGTTCACGTACTTGCTATCTGGATGGGAAGGTTCAGCGCACGATGCAAGAGTGCTAACGGAAACACACTCCAATCCTAG GTTCAAGTTCCCACGTCCCCCACCAGGTTATACTTCATAATGTATCTGTACTTATGGCTATTAATAGTATGGGGCATAAA TTGCATCCTAATTTATATAAGTTGCACAGCAAAATACTATCTTGTTGATGCGGCGTACGCAAATTTTGATTGTTTTCTCG CTCTGTAAGAGGTGGGACTTACCATTTGCCTGATTATAGAAGAAGAAGTGGTGGATTTCAGGGAACTAGAGATATTTTTA ACTACAAACACTCGTCGCTACGTAATTGTATAGAGCGAACATTCGGGGTTTGGAAGGCTAGGTTCCCTATCCTAAGGCGC CCCAATAATACGTATCCAATGGATAAACAAGTGAAGATTCCAGTTGCTTGTGCAATACTACATAATTTCATTCACATGTT TAATGAGGGGGACCCCCTTCTAAATCAATACTACTGTGATGGTGTACCTGTAAGCGAAATAGATCCGAACAATGATGATG AATTTGATTACGATGACACTGATGATAATGTTCCTGAAGGGCTAGTTGCAACAGGAGATAGTGTTAGTCGTACAGACGGG TCGTTTTAGGGATCGCCTTGCGAATGAAATGTGGGTGGAATACCAAGGAAGCCGTAGGAGACAAGTTTGACATGTGGAAA ATTTCTGTGAACAACAGGTTTCATATCTGGAAAATTTCTTAATGTCAGCTCATATAAAATGACGTCCCTAATTCTTTCTT CTGATTTGATGCTTTCAGGATGATGAATATCTTGCTTCACTGCAAGCTGACAGAGACAAGGAAGACAGAGCAAGGCAGGA GGCTGAAGCTCGACTTGAAGAGGAAAGAAGAATGGAGGAAGAATCTCGCAGAAATCTGATATGAGTGGTGACGTTGCCTT TCCTATCTAGTTCATATCTAGTTCTCAGCTTGCTTTATATTAGACTCATTGCATGGTTCTCTTAAATTATAATTCCACTT GCACATTGACTAATTTGTATACATTGCTTAGCTAGTTTAGTTCGCACATTTATGCTTATATATCCTGCTTAATGAAAATT CATCGGATTGAAAATGAATACGGAAATATTGAGGGGACGTTTAGGCAGAAAGGAAAGGACTATGTTAAATGGGCAGCTAA AGATGGCTTTGGGCCTTGGTGCTGGGGTTCCATGGGTGAAGTGCAAGCAAACTGATGCCCCATATGACATTGTAAGTTCT TAGCCTGTGTGCGTGCATGTGTTTTAAGTTAAATCGATTATTTGTTTACGCTATGTATGTACAATTCCCTCCACACTAGA AGATGTGTGTGTGTGTGTGTGTAAATTGTGGTGTATC