>DTH_8_1_Mno length=2552;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TGCGTATCTGCCAAGATCAGTTGAGTAAGAACTCATTTGATGGCACACTTTAATCTACCCTGTCAAGACATGGATAAACC ATACTTGAGCTTGTTTTAGATGCATATTAACATTTGGTCCAATTTTGGGTTATTTGAGGACCACGGATATTTAAAATGTT TGTAAACATTGTTGGCCTTATTGTACTTTATTTGCGGACCATGGACATTTAGAATGATTGTTTAATGAGTATTTATTCTT GATGACATCAAGTTGATGACTAATATTACTTAAACAGGTGATGATCAAATGCTCCATTTTTGCATATTTCTTAAACCCCA AAACTTTCATGTTATTAGTTGGAAACTTTGACAGGCATGGATCACCATAGGGACGGCGATCCAATGGACTCAAACGCATC AGACGACGATAGTGATGACGAATATTTCAAGCATGTTGTCGCGGTCGCAACATTGTTATGCATTGGATTTATATATAGAG AACCATCACGCCGAAGGCACACTTCTGGCTGGAGAGGTAGGCTTAGAGTGGACTACTATCTCAATGGGAGTCCAGAAGTG ATTTACGATAAAGTTCGCATGAGTAGTGACGCTTTTAGACGCCTATCTTCTATCCTTGAGGAAAGGGGATTACTGCAACC GACAGTCAATCATGTTGACGAGCAATTATTCATATTCCTTACAATACTGTGTCAAAACTAAACTAATAGGGAGGCGCATG ACCATTGGCAGCGCTCGGGATCCACAGCATCGGAGTATTTCACGAAAGTAGTTGAAGCGGTTTGCCAGTTAAAAATAGAC TTCATACGGCATCCAGATTTCTCTGCCGTGGATCCTCACATAATTGCAGGTGGAAATAAGTATTCGCCGTGGTTCGACGT AAGTTATACATAAATTTATTTCTCTACTTCATAAGTTTAGTCATATTTTATCACAAAATGAGTTTAACTAACACATAACA TAACAACGGACGTAATTTTGTTAATTTGAAGGATTGTGTTGGAGCACTAGATGGTATGCACGTTCCATGTGTGCCTCCCC ATGAAACGGCCGAACTTTACAGAAATAGAAAGGGGTTCTTTTCGCTTAATGTGCACGCAGTTTGCTCATTTGATATGAGA TTTACGTACATGCTATCTGGCTGGGAGGGTTCAGCACACGATGCGAGAGTACTTGCGTCCGCATTAGATCACCCGCGGAA ACGATTTCCGAAGCCGCCACCAAGTAACTGGAACAAACGTCTCATTCTACATCTACACAAACGTCTCGTTCTACATCTAC CTAATTCATAAACTGCATCCAGATTATAACTGTTGATTGTGATTACTTAAATACATGTAGAAAAATTCTACCTCGTCGAC TCAGGCTACGCAAACAACGGATGTTTCATGGCACCATATCGGGGAACAACATACCATTTGTAAGAGTATAGGAATCGTCG TGGTAGAGGCTTCCGCAGTGAACGTGAATTGTTCAACTACACACACTCCTCCCTGCGTAATGTAATCGAAAGAACATTTA GTGTGTGGAAGGCTAGATTTCGTATTTTGAAAAGCATTAACTGTTACCCCCATTGAAAAGCAAGTTAAGGTTCCGGTTGC ATGTGCTATAGTCCATAATTTTATCCACATGTACCGTAATGGAGATAGACTATTGGATCAGTACTCATAAGATGGCGTTC CGGTTGCGGACATTGATCCACAGAATGTTGAAGAGGATATCAATGACAATAACAACCACGAAGGACAACTATTGAATTAT AATGCAGAATTGGAGATGAATGTGTTAAGGGATGCAAGAGCACATACAATGTGGGCAGAGTACCGTAATCGTCGTACGCG CTAATAATAGTGTATGAAGAATTGTGATATTAATTATGTATATATTGTGACTATTTGCTCTCCATTTATAATGGAAACTC ATCTTCTAGTTATTTTTTATATGGTATTTTAATTTATTAAATGAAGAAAATGCATACGTTGTTTTTAAATTTATTACTAC TTATAAATGATTCACTTTTATTTATTCAAATTAAATTACATAAAATCAATTAAATGAAAGAAAAAAAATCAAGATACTAT TCACAACTCTAGAATTAGTTTAAACAAACACAAAGTCAAATAAATTCTAATCTCAAATTATAACTTAAGTTTACACAACC AAATACAAACTTAAATTACAACTTCAACTCAAATTCAACTTAAAATCTACACTCAAGTCACATAACTCCAAAAGGACAAA AGAACTGTCCCTTAGTGTTAAAGTACAGTTTGTTGCTATCAAGTGAAAATTTTACATTTGAAATTTATATTAAATTTAGA GGAGAATTTTGTAACTTTCCCTGAAAACCTTCGAAAACGGGAAAATTACATATATATTTTGTCGAGTTGATTCTGGTCTT ATTGAAGAGGAAAAACCTAAGATTACTTTCAAAAATGACTCATCAAACTTAAGGACTCAATCCCAATATTGCCCCTGATA TCTGTCGGAGTTTTTTGCAAAAAGTTTATGAAGTGCAGCATATTTCGCATTAACACAGGGTACCAAAATAAT