>DTH_7_1_Mno length=2573;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; CAAGCACCCAATTTTAGCCATAGACTTCCGAACTTTGGCCCTCAACAACTCCCCAATTTTCTTTCACAGCCGCCAAACAC ACACCCCCACCCGCAACAATTCCCGAACTTGTCCCAAAACTACACTCCGCAAAATTCCAACTTTGGCACCCAAACACCTT ACTACATGCCCCATTTTCCACCTTCAAGTGGGACCTTAGGTGGAGACGGAAGTCCAGAGCAAATCTGACTAGTTTTTATT TCCTTTAAAAATAGATGAGCATCATTTCATTTTCTTCCAGTTTTCATGGCATTTATGTGTTATTGTTATAGACAATTTGT ACTCTTATGTAGCAGCGGTGAGTGAGACATTTGTTGTGGTTTTTTTTTCCATTAATGTCGTGGTCCCACATTCGGATCAC TAGGGACCTTGGCTATTGAGTTGTACTTCGACTATATTATTTGCATGTTATGCAATGCGTTGTCTTTCTTTATACTGTTG AAGTTTGATGTTTATTATTGCTTTGTGAATTTCAGGGGTTGTCCTCAATGTTTTATAACTTGTTGAACTTGGAGAATTTT ATGCCTTTTTCCCAGGACATCATGTGAAATACAGGTCCTTCAAATCAACCAAACCATAATGCAGATCCTTCAAATCAGCC AAACCATAATGAAGATAGCGATGACTCAGATGATGAACATGAACTCGCAGTCGTCGCTTGTGTGCTGTGGTATTACTACA AGTACATGGATAGACCATTACCTCGACCGAAGCACACGTCCTTCATAACAGGTATTATGCGAGTCAATTACTTGCTTGAT GGACATGATGACGTTATTACGGTTTGATTTTATAAAACCACTGAGCTTCAACGTAATCGATCTCATCCTTGCTGCTCATG GTTTCAAGTATTCGTTACACGTAACTAATTACTTTTACCAAGGAAATAAAAATAATAATTGCATGTGTAGGACGTAATTG TAAATGCTTACGTATTTTGTAACATTTGCATAATTGTGTTGGAGCTCTTGATTGGAGTCATGTCCCATACGTTCCACCCC CTGGGAACCCCGAAGTATGGAGAAATAGGAAGGGTTTCTATTCTAAAAATGTGTTAAGGGTATGCTCCTTCAACATGAAG TTCACGTACATGTTAGCTGGATGGGAGGGATCTGCCCACGATGCTCGGGTGCTTGCATTTGCAACGGAGACATTGGAGAA AAATTTCCCATATCCACCCAACGACGTCGCTTTTCTATATACATATGTTCTCACTATGCAACGTTAGGTTCCAAAATTAT AGGAAACATAGCTTCAAAATCTAATTTATGATACTACACAACACATTTATCTATTTACTTTTAGATGTGTAATGCCCACT ACAAGTAAATATTACCTGGTGGACTATGGTTACGCTAACAATGATTGTTTCTTGGCGCCATACCGGGGGAGCACTAACCA CCTTCAAAACTATAGGGCATGGCATGGCTGGCCACGAAGTGAGCGTGAGTTGTTTATCTACACCAACTCGTCCCTAAAGA ATTGTATTGAGTGCACATTTGGCGTCTAGAAAGCAAGGTTTCGAATACTTAAGTGCATAAATAATTACCCAATTGAGAAA CATGTACAAATACCGATTGCGTGTGCTGTGTTGCACAATTTCATACATATATACAATAATAATGACGATATAATCAACCA GTACATGAGAGATGTCTTACCGATTATAGAAATTAATGTAGATAACATCGATCAAGATGTTAATCAGAATCACAATCCGG ATCGGAAAACCCAAAAACATCATACTCGTACAAACCGCAGACAAATGAATATATTAAGCGACGAGATGACTATTAAAATG TGGGGTGCATTCGAAAATAGCGGCCATCGGTAGTTACATATCTCTTAAGCAATTTGCACCAAACCTTTGAGATGGGTGTG TTACGTATTTTTACCCCAATTTAGAATGGTATTAATTTGGGTTTCTTATGTATGCAACCTCCCAATTTGTACACATATTA ATATGGGTTTGTAATGAAGAACAGTTGAAACCATTATCTTTGTGTTAATATGGCGCTGAATGTTCACGTATTAGAAGAAC ATATGCATATGGGCTGAATGTTCACTTTGTTTTAATATAAATCCAATGCAATATCTTTGTGTAAGTTGTGAGTTTGGATT AGTGCACGTGAACATAAAATTCAAGTTTTAAATGTGAAATCAATCTCCTACTAAACACTTAACTCAAATTTCACATTAAC TCTAATTAAAACCAACTTAAGTCCACTTTCTCAACTCCAATCACAAAATTAGAGTAGTGAAGTGAATGCACCCTAATTTA GTATTTGAGTGTATGAAATACTCTTCAATATAATACTATTTATTGTGTTAAATTTCTCATATGTTATTTTTTGTGGTAAA TTTCTCACTAAATATAGTTTAAGAGAAATTTGGTGTTTGATTGTTATTAGTTGAAATGTTTACTTTTCATGTAATCAATG CAATTTTTACATTTTCTAATTATTTTAGAAATAAAATTTACTTTTACAACTTTTAAAACTTAATAATTATAGGAAAACGT ATATTTAACATTT