>DTH_6_1_Mno length=10266;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGGCCCGTTTGGTTGGGAGATCCTGATCAAAAAATTAGAGTCATGTGCTCAACCTCGTGTTTGGTGTCGCATGGATTAGG GTCAGAGACTTGAGTTACGGGTCATGTTTTGGGTCCTGATTCAGAATCAGGCCCCCCCCCCCCACACCCAAACCCCCCCC CCCCCCCCCCCCTGATTCAGGCCAAAATTTTAATCCTTGCACAGTACTTTCACTATGCTTCGTGTGAGTTAATTCTCACC GCAACACCCAACCATATGCCAGAGAGCACGTTCTCTACCAGAGGTCCTTCCAGCCTTCGGTCGTGGCAGAGATTCTCTGC TCTTCCTTGGTTCTCCTTCTCATCTTCCCTCGTCAGTGTTGTGTCGTGTCTTGGCAGAGACACGTTCCCTCCTTCCAATT TTTCACTCCTCCGGTCGTGTCTTCGTAGAGATTCTCTGCTTCCTCTTTCTTCAATTTTTCACTCATCTCTTCCCTCATTT CTTCGGCCAACAACCGTGTAAACAACCCAGTTGATCTTCACCTCTCTGAGTTAATGAGAAATGCTTCGCGTAAAGCTCTG CTCGTGAACAAACGACCGAGGCTTCACATTCGGTACCAATTTCGTCGATTCTATAAAAGGTTGCCCACTTCACGCCTTCG CCGGAGAGGAACAAGACGCTCATCGGAAACATACAAAAAACCTTCATCTGCGTTTGGTGTTTTGCCGGCAGTGACGTTAA TCTCCTCCTCAGATTCGAACAATTTACCGGTAAGTGATCCTCACATAGACTCCGGTTGATTTGCCTGTTTGGGGATTAGG GTTTCTGTCAATGATTGTTTGTGTTCTTGAATGGTTGTTGTCAGTAGAATTTAGGGCATTTTGTGGAAATGGGATTTGTA GAATATAGAACACGGTTGCATCTTCTGTTGTAGCATCATGTCTCACTTTCCATTCTTCACATAGGTAATTGATTTGCACA AAAAAAAAAAAAACACAGTCAAAGCCTTTTGTGTCCAACGTTTGTTTCCCCTGATACGCTTGTAAGCAAGTAATGTTATT AAGCAACTAATGTTAGTACGCTTAAACCAGTTTGCCTTGCATGCAACTAATGTTGGTAAGCAATTTCATTTGAAATTGAA GCAGAAACTCCATTAGCATTAGCAAATATTAACGGGAAATGGTATGATTCTTTACTCCCGAGTTTGCTATGCCAGTAGAG TAATTGTAACACAACAACTTCCACACTTTCCATTTCATTGTCGTATTCCACCCTAAACACACCTTCCTCATCTTTCCCAA GCTTCCCCGCTAGCTGGTAAGCAATTTGGTTTGATATGTGTTTTTTTAGTGATTTTCACCTTTGATTTTTCCATGGCTAG TGAGATGATGATGATGATGAGATACAAGAGAAACTTTTTCACTACTTATATTGATTTATATATAAAAGGGTTGAAAGTTT TAGTGGGTAGAAAATTTTGAGAGGGATTGTAGTGTACTTATAGTCATATAGAAGTGGTTCCTTCTCGTGTAGTTGGCTAG CATTTATGGGTTTCCTTGCAAGCAGTTGTGGCCAAGTCGGGATGGGAAACACACATAGAAGTTAGTATTTTGAAATGTGT AAGGTAACGACATAGGAAATGATAAAAAAATAGTGTTGAATTTGATGGTCAGTGCAACAAATAAGACTTAAGTCATGTAT GCATTTTAACTCGAAGACAAGGAGAAAAGCAAGGGTTTCTTCCTCTATGGATTAGGAAGAGAAAGGATGGGGAAATTTCA AGTTTCGAGGTGTGGACGGTGGTTTTCTTGTAAGGGGTTGAGGGAGTTGCAGCAAGGGGTTTTAAATTTTTTTTTGACTA AGTTGAAAGACTAGCCTCAACTAGGATTTCATTCAACTAAATAGACAATTCTACAGGAAACAATAGAGGCTGGGAATCCA ATTCAGCAACCTCAAACAATTGCAAATTTTGCATTTTTAATCCAGGATTGGAGTGGCCCTTGAGTGTTTATTAGCAACTG TACCTAGTAATTTTCAGGGCATTTTTCAATCCCTATTGTTATGTAGATAGACCATAAGGTTAAAGCTCCAAAAGACACAC ATAAACTCGAAGCATAAGATTTATTTCTTTTGGTTGTCATATGCGTTTGTAGATGCCTAGGAAAAACGCGGATGAGAGGC CATTGTGTTGGAGCGCGGATTCGGAGGTGTTCCCACTTGAGCGTCTCTACGAGTACCATTGTGCCAACAACGGGAAGCAA CCGGAATCTTGTGACTACAACCAATGGGCTATTCAGATGGCCACTTTTTTTTATGACTATGTACCAGCTGGTGAGCGCCT TAAGGAGAAACGCCGCCGACTTAGTAAGGTATACGCTGTTGGGAATAATGTCCTAGAAGCATGAGATGTAATAGGATATT TATTATTTATTTAATAAAAGAGTTTATTCATTATTTTATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGATAGGAATCCCTAG CATGGCCGGCCACAAGGGATAAAGGATAGAGGAGAATTTTGGTTCGAAATTCAAATTGGAGATAGAGATTGGATTCTTTC TAGAAGTTTGACTTCTACTCTATAAATACTATTTTTGAAACAATTTTCGGAATGGTTTTTTACCCTAATTTTAGAGGTAA CCGAAATTTCTTTCTAGAAATTTTGGAAATAATTTTTCAGCCCTAAGGGTTAAGGTTGGCCGAAATTCTCAAGAGAAAAA GGAAGGAAAAATTTTTTCTCCAAAAATTCCACATCGTGCATGCAATGGTGTTTGTGGAAATTTAAGTGTTTATTGAACCC GTTTTGTCTCATGTGTGCCCACACACACGTCTTCGTGGATTCTAAGAATTGACGTGGAAGACATTGGTTTTCTAAACACA AAGATTGGAGCAAGGACTGTTCGTGGTCAAAGAACTCAAGTTATTATCCGAGTCAGCTTCCAGGTATTTTTCTAGATTGA GTTCTTGATATATATTAGTTAATGAGATTAATTTATTCGTACATAAATTAATATAATCTATAGAGTATCTCAAAAGTTTT ATGAAAATTTTTGTTATACACGATCCGCCTCTTCCCCGCACCACCACGCTTCCGCATCCGGATTAGATTCGGAGACCAAC ATACGCAGCATTCAAAATGTTGCAAGCCCATACTGGAGTTGGGTGGGATTCTATCAACAAAACTTTCACATGCTCGGAGG ATCTGTGGAAAGATCTTTCCAAGGTATAATGTGTGATTCGTTAGTGGTCCTTCATTCAAAAATATGGCAACGTACATTTT ATGTAATAAGTGTAAATAACTATAATTTTGTTTAAAATTTTGCTAGAGAAACCGTGAAGTAAACACAATTTTCAGTAATG GTTGGAAGCTTAACGACATGCACTTGGCTGCCATTTTCCCCAGTCGAGTTGTCGCTACTGGTGCAAGATCATTCCACCCC TCCATGGAACAAGAGCATGTGGACGGTGTCCCCTCGAATGACATTGAAGCTGGGATTGAGGAACCACAAAATGAGCAAAA CTCTCCGTACCAAGACATTGATGATGATGACATTCGAGTGGAGTTTGGCCGCCGCATGGAACGCCAACGAATGGAAAATG CGACCAACGTCGTCTCGTCATCACGTACGATTCGGAAGAGGTCGACAAGGTCACGCAAATCCAATGACAGTACGTGAGAG GAGATGCTTGAAGCGGTGAAGGACATGCGCAATGATTTGCGGGAAGATATTCAAGCAAGCAAAGAGACCCTCCCAAGTAA CAACACCGTCAATGGACCATGTGAAGTGACTCTGATACTAGAGTCGCTGGTCCAAATGGGAATTAATCCGCGTACACGTG TCCATGCGATTAAGAAAATTGCTAAGGACGACACATGGCGTCGGGCGGAGCTTGATGATTCGTCGAGGAGAGCCTTCTTA GATGACTTTGTTCAACTGCCCCAAACCCCTTTTGTTCCTAATCGTTATAGTCAGCCACCTCAAAACTTCTCGCAAGTACC TAATCCTTATAGCTAGCAACCAACCCCCTTTGGACAGGCCCCAAGCTCCTTCCAACATCCACCAAACCCCTACAACTAGC AACTTCCCTCCTTTGGACAGCCCCCGAGCGCCTTCATGCATCTACCTAACCCATATAGCCGTCCACCGACTCCTTAGGAA GCATTGTCACTTGTAGAGTCTTCATTTGTGTGTTAAGTATGTGTTGTGATAGGTCGAGTTGTAAACCCCCGAATTTGAGT TTCTATTAATTTTAGTCTTCATTTGTGTGATTTCGTTACTCTACTTTCATTCCTAGACTGTACTATTGTTTTAATTTGAG TATGACTTTGTACCCCGGATTTATGTTTATGCAATATATGGCACTTTCCCCTTCATTTCTGCGAATATAGCAAGAATTCT TTGTAGTCAAACTAACCGTTGTCAATGTGTTTGGTTTTACTTGAAGAGAATTTAGTTTTGTGCCCTCACTCTGTTTCTAG TTGGATACAGTTGTTCTAAAAACTTTGAATTACTGAGTTGTATGGTCATTGATACTTTCGATGGCGTTACTGAATTTGTT TGTATGACCGTTTGCAATAGACTTCGAATATGCACTCCACCCAAATGACATGCAAATGTTGTGTACAGGTTAAACCGTGA AGCTTCAAGATGCAGGGAGAAGGATCCGGACATGCAAATGACGACCATTAGAGAAGGGCACATTCTAGACGACGACGGCG CTTTATGGCTGCAATCGTAACGACAATAGCCAGTGCCGAGTTTTTGGATAGTGACACAGTACCACGGCCTGTGCACATTT CTTCTCTGAGGGGCATCGATAAGGTAAATGAGTTGTTATCAAACAATAATGAAGCCGATATGTTTAACAAGGTGCGTATG GGACCACGTGCATTCATGATTCTCTATAACATACTAACTGAACGCCGATTGTTACAACCCTCTTACAACATGAATGTACA AGAACAATTATTTGTGTTTTTAACAATCGCTTCCCAAAGTCAACCTAACCGTGAAGCTCAAGACATATGGCAACATTCTG GGGAGACAATTTCACGGCGGTTTGGTGATGTTCTCGATGCTATATGTGCACTACACGATGATTTTATTAAACCCCCTAAC TATGAGAGAGTTCATAATTTTTTACGTCAGAATCGTCAAAGATATGGAACATGGTTTGACGTGAGTTCTCTAGCTATATT ACCTCGGTCTTGTGTTACTCACTCCACTAATTGTTCTTACTTATAATATCTACAATCTAATATTATTGTTCAGGATTGTG TAGGTGCAATTGACGGAACTCATATTCCTTGTACACCGATTAGAATTCCAAATCCTATAGCGTACCGCAATAGGAAGGGA GTGAACTCCCAAAACATATTGGCAGTCTGCTCCTTCGATATGAAGTTCACATACATGCTATCTGGATGGGAAGGTTCAGC GCACGATGCAAGAGTGCTAACGGAAACGCACTCCAATCCTAGGTTCAAGTTCCCACGTCCCCCACCAGGTTATATTTTAT AATGTATCTGTAGGTATAGGTATTAATAGTATGGGGCATAAATTGCATCCTAATTTATATAACTTGCGCAGGAAAATACT ACTTGCTGATGCGGCGTACGCGAACTCTGATTGTTTCCTCGCTCCCTACAGAGGTGAGACTTACCATTTGCCTGATTATA GAAGGAGAAGTGGTGAATTTCAGGGAGATAGAGATATTTTTAACTACAAACACTCGTCGCTACGTAATTGTATAGAGCGG ACGTTCGGAGTTTGGAAGGCTAGGTTCCCTATCCTAAGGCGCCCCAATAATACGTATCCAATGGATAAACAAGAGAAGAT TCCTGTTGCTTGTGCAATATTGCACAATTTCATTCACATGTTTAATGAGGGGGACCCCCTTCTAAATCAATACTACTGTG ATGGTGTACCGGTAAGCGAAATAGATCCGAACAATGATGATGAATTTGATGACGATGACACTGATAGTAATGTCCCTAAA AGGCCAGTTGTAACAGGAGGTAGTGTTAGTCGTACAGAGATTAGTCGTTTTAGGGATCGCCATGCGAATGAAATGTGAGT GGAATATCAGGGAAGCCGTGGGAGACACGTTTGATACGCAGATTGAAGCTGAAGCTTAATGGGGTAGTTTCTTTACTTCC ACATTTTTTGCATTATGTTTTTGTTTCTACCTTTCATATGCTTTCTTTGCATAGAGAAATTTGCATACTTGTGTATTTCA ATGAAGAGAAATTTGAATATGGCAGAGGAAGTGTTTGGAATTTATACCATGCTGGTGACACGGTTGGTGTGTTAGCTGCA ACTGCAATGTCAAAAATCGCATATAAAGCAGTTCTTAATTCTAGTCCAACCAGCAACTCTTCTTGGAAATTAGTTAAGGT AATTACCTTTTGACTAGTGAGTTTTGTTACATTCTTGCTTTGTTTGAGTATAGTTGGACTTTGGTTTTGGGGAATGCATG ATGTGGATGTTCTTGATGATGTGGGTTTGTAATTTGTGCTCTCTAGGAAATACTACTTTGCAAGGCTATTTTCATAAATG AGTTTAAATATTGCTGAGAACAAGCTGTATATTTGGCATCCTAATCAAATAGAAGACAGTCTTAAAGATACTGCAGTGGA GTTGATGATTAGTATGTTCTTTCCCTACCTTAATTGTGTTATATTTCCTATTTGAGGGACTTCTAGTTATATACAATTAC AGATGCATCATTTTCTGATTATTGGTTTTATTTGTTAATATGAAAACTCTAAACAAATGCCATAACAGATATCTTCACAT ACAACTGTGAAGGGTATAATACATACAGATTCCATGGTGTACCAAAGTATCAAATAATCTTTGCCATGAACTCATGCGTG GTAGATAAATACAACAACCATATTTAACTAACGAGCAGTGCATAATACCTCTATCAATAGAGCTGATCCGCATCTGCAAG CCCAAAAAAAACAGTGTTAAAATGTCTGTGGACATAATTCCAGGGAGGTTTCTGGATAGCAAAGGTCATGGAATGTCTGG GATAGTTCATGGAATGGTGGCTCTCAAAGTTACTTTGGCAGTCGTCTGCTATAATAAACGGTCATGATGTAGCAGAAATT GTTCATGGTTTGATTTTTGCCATACATTTTTTTGGGTCCCCTATTGAGTTTAGCTACCCAGGAGGCAGGAAACACCATTC CTATTGAGAATGCTGCTTTTTAAACTAATCTGCCCTATGAAGTGTTCATTGATTGAAGGATGAAGGGAAGCTTGTAAAGT ACAAATTCGATTTTAGTTGACACTATGAAGTGTTCATTGATAGTAGGATAAGTAAAATCTTGGACTTTTCTCCTGCATAC GTTTATTCCTTTTAAGATCTAAATCATTAGTTTTTTTGTGCTTCATTAAACATGGTTTTTTTGTGCTTGAGTATGTGAAG TTTGATCATTTCTGCTTCAGTATGTTACGGCAAACTGATGCTGTAACATTGTTTGTAATATGGTCCTCTTTGTCTAAGTT TGAGATGGAAATGGTGAATGTTGTGCAATAAAATGCTTGGCCAGATAGTGACCTGATTGTGGCTAATGGTATCCCTTAGT GCTTATCTGATTGTTCTACTCTCACGGATTAGGATGCTATGTGTAAACTTGATTGCATCTGGATACTCCTTTTTGAACAT ATTTCTCAATGAGGACACTTGTTGATGCCAAACGAAAAAATGGCAAAGTTGGTATAGCTCCTTGTCGAAGTAAAGTATTG GAAGTACTAATGCTTTGCTATATATTGGATTCCCCCGGTTCTTCTGTTCCCTGTCAAACCAAACGAAAAAAAAGAGTGAC GGTTCTACTGTCCGTCAGTGTCAACTTGGATTGCATCTGGATTCAATTTTTGTTCCAAAAAGGTCACGTTTTGATGCCAA AGAGAGCAAAGTGAATATTGCTCCCTGCCAAAGTAAAGTAAGGGACGTAATCAATAGAAATCTTACATAGTGGGAGTATA TATACCACTTCATTACTATGAAATTTTTTTTGAAACCATAACATAATATCCCATTTCCAGCAAAAGGTAAAGTACATAAC GTAGAGAATCTGGATTTTCCTAGTTATATCCCTTTGGCGTCCATCTTTTATATTCACATTGTTGTTGTTCTTGACTCGAC TTTATTTTTCATATTGTGATTCTACAGATCCTGCAACATCATCTTCAACTTTTACAGAATCGTAAACCCAATGAAGTCAC AAATACCGAAGCCGGATTAGCCTTCGGCAGTAGCCAGGAGAAGAATGTAGCATATGTTTCAGAATGCCTTCGCCATGGCA AGATTGATTTACTTGTAGCATTTTCAAAATGTACTACTATAAAATATCTCAACTAGTAGACCCAGAAATGTGCATATAGG GGAAACACAAATAGATAAAAGAAGGTGTTGCATTGGTAATCAGAGAACCACTGTCGTTTGACATATGACAGGGTACTGAG CAATGTGGTATTGTTTGTTGTTGCCACCAACCTTTGTTGAATGGTTTATGGCTTTTTACCGGATCTTGATGTAACTTGTC CATTTGTAGTGCTAATTTGTACACAATTTCATTTCCTTTTTTCCCCTCTTGCTGTTTAGTTTTGAATAATTTGGAGTGGA TAACAGCAAATATCAATTAATGTACTAGTTGGCACCGAATGTTCAATAGGGTTGAAATATTTTTCCAATCATGATCAAAT TCAATTGAAATCTTTCGATCGAGTGATTCGTGTTGCGTCTTGATTGTATGGCATACAAACAAATCATTTTTTTCTAGTAA TTGGCTTGTTATACAATGGAAGTCGTGGGAGACAAGTTTGATATATGCTTGGCTTGTTAGATAATTTTATTCACATTTTT TTCATTTATTTCTCACTTAGCTTGTTATAATTCTGAGTTATAATTAGTTGCATAATTTTTTTTTAGTACTTCATTTTTTA ATTATATGACGAATTATATTTTTTTTTAAATTACACGTAATGAATTATATTTGTTATATAACATTATTTTGGTCATGATT CAAATTCAGAAAACAAAACAACCAAATACTGATTCGAATCACATTTTAGGTTAGAATCAGAATCATGCATATACATATCC AAACAAAGGTTCTAATCACTCTAAATCATGATTCAAATCATGAATCATGATTCAAATCAAAAAGACTCAAATCATCTTAA TTTCAATCCTTATACCAAACGGATCC >DTH_6_2_Mno length=6229;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGCCCTGTTTGGTTGGGGGATTCAAGACTAAAGATTGGAGCCGTGTGCTTAAATTCCTGTTTGGTGTCGTATTGGACTGA GACCACAACTTGAATCACGGATCATTTTTTAGGTCCTAATTCAAAATCATGCCCTTCCCTGATTCAGCCCAAAACTCAAA TCTTTACATAGTAACTACATTGTGTTCTCTGGAGTAATTCCTCGTGACCAACCCCTAACCCAACTCCACCAAACTCCACG TTCTTGCGCAGAGAGCTCAGCCTTCGGTCGTGTCTTGGCAGAGAATCTCTGCGCCTTCTCTTGTTTATGCTTCTTTCAAA ATTTTCACTTATCTCTTCCCTCATTTCCTCCGGTCTTCGGTCGTGCTTTGGCAGAGATTCTCTGGTAAACAACCCAGTTG CTCTTCTCATCTCTGAGTTGATGAGAAGTGCTTCGAGTAAAGCGCTGATCGTGAGCAACCGTCAGGCTTCACATTCGGTA CCACTTTCACCGATTCTATGAAAGTAAGACGGCTTCACGACTTTGCCGGAAAGGAACACGCCGCTCATCGGAGAAGTAAA AAAACCTTCATCCGCGTTTGGTATATTGCCGGTAGTGATCTCTTCCTCAGACTCGAATGCTTTACCGGTGCGTGTTCCTC ACATTATTTAAATTTTTTTCATGGTAATATCATCAGATCATGTTATTTTGCAGTTGATTTGCATGTTTAGTTTCTGGCAA TGAAATTGGGGATTGGAGTTTTTGTCAATGACTGTTTGGGTTCTATGGTTGCTGTTAGTAGAATTTATGGCCTTTTGTGG AAATGGAATTTGTAGAATATAGACCACGGTTCCACTCGGTTTCAAAATTTTCTTTGTCTACTGAATCGGACTTTGATGTA GGAAAAATTACCTTAAAGTTCATTTCTGTTCTTTCTTTTGATATGAGCAACTGTTGGTACCTATGCTGGTACTTTATTGC CTTCAATTTCCTGAATCGGATTTGGGCTAACTATGCTGGTACTTTATTGTTTTGTTTTCTTGTGATATGAGCAACTGTTA ACTGAATTTGAGCCTTTTCTCTCATCACAAACGACCCCATATCATTAAAGATTGTTAACCCACTACTCTCCCATTGCTGC TGAATCTTACTTGGTCTTTAATACTCTTCGAATGGAATCATGGCATTCTACAGAATGCTCATTTCATTACCTGGTAGCAC AAAAGAGCATTGCTATAGGATAGGAAAAAATCATGGATTTCTATTTGCTGACTAGATATTACCTTTTGCTCCTTTCAGAC TGTTATTCATGCTGAAAGTTCTTGCAGAAGGATCCCAAAAGCTTTGTATTTTGGTATTTTCTTTTAAAAGCATTGTTATT CTTGTAAAAATATGTTATTGAAACAATCTTGCTGTGTTCATTCTATAGATTTATATAATTTCATCATATTCTCAAGATGA TTATGCGAGTCGAACAACTCACATGCTTTTTAAAAAAAAAAAACTGCACTTTCTCTGCCCCACTCATCTTTTCTTCTCTT GCATATTTCTCTGGTTTTCACCATATAGTTATCCCTATTTGGGTTGACTTCTGTTTTACTCATCAACATGAGAAAACGTG TGATGCTCTGTGCCATTGTGCCTGTGACGTTTTGTTTGTTAGCGTAGATAGACCATGAGGCTAAAGCTCCAAAACACACA CATAAACTCGAGAAAGAAGATTTATTTCTTTTTGTTGTCATATGCGTTTGTAGATGCCTAGGAAAAACACGGATGAGAGG CCGTTGTATTGGAGCGCCGATGCGGATGGGTTCCTACTTGAGCATCTCTACGAGTACCATTGTGCCAACCACGGGAAGCA ACCGGAATCTCGTGACTATAACCAATGGGCTATCCATATGGCCATTTTTTTTATGGCTATGTACCAGCCAGTGAGCGCCT TAAGGAGAAACGCCGCCAACTTAGTAAGGTCTACACAGCGTTCAAAATGTTGCAAAACCATACTGGAGTTGGGTGAGATT CTATCAATAAAACTTTCACATGCTCGGAGGATCTGTGGAAAGATCTTTCCAAGGTATAATGTGTGATTCATTAGTGGTCC CTCATTCAAAAATATGACTAATTACATTATATGTAATAAGTGTGAAAAACTCACAATTTTGTTGAAAATTTTGCTAGAGA AACTATGAAGTAAACACAATTTTCAGTAACGGTTGGAAGCTGAACGACATGTACTTAGCTGCCATTTTTCCCAGTCGAGT TGTTGATACTGCTGCAAGAGCATTCCACCCCACCATGGAACAAGAGCATGTGGATAGTGTGTCGCCGAATGAAGTTCGAG CTAGGAATGAGGAACCACAAAACAAGCAAAGTTCTCTGTATCAAAATAGTGATGATGATGACGCTCGCGTAGACGTTGGC CACCGCATTGAACGTCAAGGAAGGGAAAACGCGACCAACGTTGCCTTGCCTTCACGTACGATTCGGAAGAGGTCGACAAA AGCACGCAAATCCAATGACAATACGCGAGAGGAGCTACTTGAAGTGGTGAGGGACATGCGCAATGATTTGCGGGAAGATA TTCGAACAAGTAAAGAGAGCCTTCCGAGTAACAACACTGTCAATGGAAGAAGTGAAGCGAGTATGATAATATCGTCGTTG GTGGAAATAGGACTTGATCCGCGTACACGTGTCCATGCGTATGATAAAATAGCTAAGGACGCCGCATGGCGTCCAATTTG GCAAGATCTTGATGATTCGACGGGGAGAGCATTCTTACAGGACTTTGTTCAAGTGCCCCAAACCCCGTTTGTTCCTAATC CTTATAGCCAGCCACCTCCAAACTTCTCGCAAGTACCTAATCCTTATAGCCAACAACATACTTCCTTTGGACAGCCCCCA AACTCCTTCCATCAGCCCCCAAACGCCTACAACCAGCAACCGCCCCCTTTAGACAGCCCCCAAACTCCTTCAATCAACCA CCTAACCCCTATAGCCATCTACCGACTCCTTAAAATGCATAGTCACTTGCTTATTTCTCCGCATTATGTAGTATGAGATG GTCTATTTTTTCCTTATAGTTGACCACGGAATAGTGATTTCGTTACTCTTCATTTGTCAGCTTCATATGTGTTGTGATGG GTCGAGTTGTCAAACCCCGGATTTGAGTTTTTTAATTAATTTGTTTGTGTTTATTTGTGTGATTTCGTTACTCTTCTTTC ATATGAGACTGTACTATTGTTTTAATTTGAGTATGACTGTGTACCTCAGCTTTCTGTTTATGCAATGGAAAGTGATTCTA TTCTTGGAAATATATGGCACTTGGGATGTGTTTTGTTGTTGTTTAATTCTTGCAGGCACGGCTCTAGATCAAATCTCAGT GTGATAAGAACCTTTGCAGCAAAAAGAAAGACTCAAATGAAAGAAAAGAACTTTTGTTTTGAAAACAATTTTTTCTTTTT AAAAAAAGACGAAAAAATTTTGCTTGCTTGCTTCTTCTTCTTCTTGTTTTGTTTTTGTTTTTTGTTTTTTTTTGTTTTTT GTTTTTGCTGGTAATAAGGGTACTTTGCTATTACCTTCTTTATGTTTTAGACTGGTTAGTACCTTTATCGCACAAGCCCA TTATTGCCAACTAGCAATGCAGTTTGAAATACAAAACAAGAAGAAATGGGAAATGTTTTACGTTGCATCAACTTAAAAAA TGTTGAACAAAGTCCGCTTTAGCTAGTTGATCTCTTCGGTCCTTTCTGCCTCTTCTAAACCTTTTTTACACTCTCTAAGA ACATCCTTCTTCTAGAATAACGTATTGGGAAACGACTATTATGTATAAAGCAAGAATGATTTCTTGATTGGCACCATTTA GGTAGTTCATGAGATTGGGATTGCTTATGTTCTTCTGTTGGTGGCTCTTGCAATCACTTACCTCGTGCACTAACATGGTT CTACTCCTCTTGTTTTGTTACGAGTTATTAGCTTGCACGCATTAGCAAACGACGGCCCCAAGATTCTGCTTTAGAAAAGT GTAAGCAACACAAGTCCAACTGTGCTGCACGTAGCAGTTTTGTCTACCACCGTACTTGATGATCTAGCTAAAATGCATAC CGTGCTCCTTGGTAATGATCCTCAACTACCTTTGTTTTCTTTTTTTCTTTTTTTTTTCCAGATTAGCCCCCTTGACAACC CTTAAGTTTAAACTGAGGACCTCCTAACCCAAATCCTCGACGCCCCCTTCCACCGTACTTGTATTACTGGAGGAGCGGTG CCTTTTGTACTTTGTGAAAAGATTGAGAATTAATATGAGAAGCTATTGATTTAGTTGGCAGTTATATTGCCTCATAAATT GTTTTGATGTTTGTTTGTGCATAAGAACAATTTTCTACCTTATGTTGTAATCTTTATATGAGATTATGTTGTGTACAGGT TAAACCGTGAAGTTTCAAGATGCATGGATCCGGATATGTAAATGACGACCACCAGAGAAGGGCGTCTGCTAGACGACGAC GACGCTTTATGGCTGCAACCGGAGCTGCAATAGCCGCTGTCGCATTTTTGGATATTGACATAGTACCAAGACCTGTGCAC ATTTCTTCTCTAAGGGGTATCGATAAGGTAAATGAGTTGTTGGCAAACAATAATGAAGCTGCTATGTTTAACAAGGTGCG TATGGGACCACGTGCATTTATGGTTCTTTGTGACATACTAACTGAAAGACGCTTGTTACAACCCTCGTACAACATGAATG TACTAGAATAATTATTTGTGTTTTTAACAATTGCTTGCCAAAGTCAAACTAACTGTGAAGCCCAAGACATATGGCAACAT TCTGGGGAGACCATTTCACGGCGGTTTAGTGATGTCCTCGACACTATATGTGCACTACACGATGATTTTATTAAACCCCC TAACTATGAGAAAGTCCATGTTTTTTTACATCAGAATCGACAAATATATGGTACATGGTTTGACGTAAGTTCTCTAGCTC TTTCACACCGGTCTTGTGTTAGTCACTCTTTCAATTGTTCTTATTTATAATATCTACAATCCAATATCATTATTCAGGAT TGTGTAGGCGCAATTGACGGAACTCATATACCTTGTACACCGATTGGAGTTCCAAATCCTACGGCGCACTGCAATAGGAA GGGTGTAAACTCCCAAAACATATTGGCAGCCTGCTCGTTCGATATGAAGTTCACGTACTTGCTATCTGGATGGGAGGGTT TAGCGCACGATGCACGAGTGCTCACAGATGCGCTATCCCATCCTAGGTTAAAGTTCCCACGTGCCCCACCAGGTTATACT TCATAATGTATATGTAGTTATGACTATTAATAGTATGGGGTATAAATTGCATCCTAATTTATATAAATTGCGCAGGAAAA TAATATCTTATTGATGCGGTGTATGCGATAATGATTATTTTCTCACTCCCTATAGAGGTGAGACTTACCATTTGCCTGAT TATAGAAGGAGAAGTGGTGGATTTCAGGGAGCTAGAGATATTTTTAACTACAAACACTCGTCGCTACGTAATTGTATAGA GCGAAAGGCTAGGTTCTCTGTCCTAAGGCGGCCCAATAATACGTATCCAATGGATAAATAAGTGAAGATTCCAGTTACTT GTGCAATACTATATAATTTCATTCACATGTTTAATGAGAGGGACCCCCTGCTAAATCAGTACTACTGTGATGGTGTACCG GTAAGCGAAATAGATCCGAACAATGATGATGAATTTGATGACGATGACACTGATGGTAATGTCCCTGAAGGGCCAGTTGT AACAGGAGGTAATGTTAGTCGTACAGAGATATGTCGTTTTAGGGATCGCCTTGCGAATGAAATGTGGGTGGAATACCAGG GAAGCCATGGGAGACAAGTTTGATATATGCTTGACTTGTTATATAATTTCATTCACATTTTTTCCATTTATTTTGTAGTT AGCTTGTTATAATTTTGAGTTATAAATATTTGTATAATTTTTTTCGTACTTCATTTTTTTAATTATATAACGAATTATAT TTTTTTAAATTACACGTAATTATTATATAATTTTTTAACTTACATTTATTTTGGTCATGATTCAAATTCAGAAAACAAAA TAATCAAACGCTGGTTCGAATCACATTTCAGGTTAGAATCAGAATCATGCATATACACATCCAAACGAATGTTCTAATCA CTCTGAATCATAATTCTGAATCAAATGACTCAAATCACCTTGATTTCAATCCTTACACCAAACGGATCC