>DTH_6N_1_Mno length=357;Class=DNA transposons;Order=MITE;superfamily=MITE; TAATGTTAGGATCCGTTAATGACTTGGGAACTTGTTTGGTTAGTGGGCTGGTAGAGTTAGTAGGAATTAGTATAAATAAA GGGCTTAGTAGCTCACTAGAGGTAGGCTGTGATTTTGAGAGTTTTGGGAGACTGAGATTAGGGAGAGCTGGTGGTCTCTC GAATACCATCAAAGTTAGGAGTTCTCCGGAGTCCTCGAATACTCCAGTCTATCCTAAGCTTTCTTTACGTTTTTCTTAGT TTGGTTGTAAAATTCTATGAGCTAGTGTTGGTGATGATCAATAAAACTACTCTGATTGCCTTCTATTCTTGTTCTTCTGT GTGAATATTGAGCTGTGAGAATCAGGTTCCTAACAAT >DTH_6N_2_Mno length=350;Class=DNA transposons;Order=MITE;superfamily=MITE; TTGTTAGGATCCTAGCTCAGAAAATCAGCCAAACACCAATACCACACTCACACACACCAGAAACAGCAAGAAAATGAGAA TAATTGGAGGGAATTTTATTAATCTAATCAGCCAAGAACACCAAATTACACTGAAATGTAAAGGATAGAACGGAGAATTC GAGTACTCCGGGAACTCCTAATTTAGTGGTATTCGAGAGACCACCGCTCTCCCTAATCTCAGTTTCTCAAAACTCTCCAA ATCACAACATACCTCTAGTGAGCTACTAAGCCCTTTATTTATACTAATTCCTACTAACTATACCAGCCCACTAACCAAAC AAGTTCCCAAGTCATTAACGGATCCTAACA