>DTH_5_1_Mno length=5710;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGCCTTGTTCGGTTGCTGCAGTTTACTCGAGAAAGGCTCACTCGAGAGTTAAACTTGGCCTAAGTTCGCGTTCGACGTGT CAAAGCTCAAAACGAAACTAAAAAATTAATTCGAGTTACCTACCTTGTTTCGAGTTCATCTTCCCACTACAACTTGAGTT AACTTCTCTGTATTTCTACAGTGAAGATTCCTGCCTATTGACCTTTGCGTGCTTCATCCATCTCTGTTAGCTCTAACACG CCATTCTGCTATTTCACCTGCTTCTCTATAAGTGTGCCGTTGCCTGGTTTATCTCGTGAGATTCCTGTGAGTTCTGTTGC CTTTTGAACATAATTCACTTCTTCAAGCTTCAATTCTACTCCTTAAATAAAAATTTCCGCCCCATATGCACAACTCAAAT GATGCCTTTCCCTCAATCTGAGATAGAAACCCTAGCCCCAAAATTCACCCCTCATCTTCTTCCGCCTGGTCTCCGTTCAA GACGGAGAAATTTAGGGGTAGAAATCAATCTCTTTGGCAACCTCCTTGGGCAACCATCCTAGCTCGATGTAAAAGGAAAG GGTCTCGACCTAGTGCTTTCCAGTGGCGATGTCAAATCTACTTCCCCCTCCATTGTCGTCGCCGGTACCTCGCTTAGGGT AAATCGTCTTCGCGTTTTAGGAATCTCATAGCAGATCAAACTTATTCCTCTGTAGACTCTAACTCGGTAAGCACTCAAAT CCTTAGTTTAATTCCTTCCAAGTTCATTATCGTCAACGGTGCAGTCGGTAAGACTTGTATGCTCATCTCCTACATCAGCA ACACTTTCCCCATAGTAACCAAAAAAAAAAAAAACTATTTTTTTTTCTTTTTTAACTTTCTCTCTGGTTTGTTTGGTTGT CGAGAAAAGTAAGGAAAGAGAAATCGATGAGAGAGAAAAGGGATATTTTTGTTTCTTTTAAGGTTTTCTGAGGATGGGTG CTCTTTTTCAATTTTCTTCTTGTAACCTCAAGTTTATGTTCGGGAAACGAAGCTCTAATGGGCTAGAACGTAGTTCATTT GGCTCTTATCATTTCCATTTTCGTTGAACTTTCTGTGTATAAATTGGTCAATGTGTTTCCCTATACCATTCTTGAAGGAA AAAAAAGAGATTGCTTTGTTTGTCCTTGACTTAGTTCGTGTTCTGTTATTGTTTGAGTTTACTTCCATAAACTTTAGGAT TGCAGAGCTGTGAAATTGGATTGTTTTTTTGTTACATGTCAAAAATATTGTGATAGTTTGCTGAGATTATGACTTGTGTG TGAGTTGTTGAGATTGTGTTATTGTGGAGGTTATGCGTTGTTGCCCTTATTGTTATGTGCGCTCTGTGGCTAGAAAGGAA CAATCAAATTTTTGAGGCCGTTCATAGATTCACTAGCTAAGTTTAGGATATAATCAATTACTGGGTTGCATTGTGGTTGG CTTAACCGAAAAATTTTAGTGGGATCTCATTTTCAGATTTTCTTAAGGGTTCGGACATTATTTTGCACTGAGCAGGGATT TTGTTAAGCTTTTAGGCCCTAAGGTTCTTTCTGGTTTTGCTCTTTTTTGGTTGTTACTTGATAAGTGGTCTCTCGCACTA AAGAAAGGGGCTTGGGCATTCAAAATCTGTTGAAGAAAAATCAAGTGTTGTTGGGTAAATGGCCTTGGTGGTTTCCTGTG GAAAATGGCTCTTTTTGAGGTTCCATAATCAGAAATACATGATTCAAACCAATGGATAAGAATCAAGATAAGATTTTGGT ATGGTAAGTGGTATGGTGATTTGCCTTTTGCAATCACCTTTCTCAGGCTTTACCGCCTAATTTGAGTCAAGGGAGTGAAG ATCAAAGAAGTTTCAATCACTGGAGTAGACTCTAGTATTAATTGGGATTTTGGCTTTTGGAGGAATTTAAGTGACAGAGA ATTTGGTCAACTTTTTATTCTTTTTCTTGTCTTGCGGACTGTTTCTCTAGACCTCTTCAACTAGTTTCTGGTTGCAATGT ATTCATTATTATCTAATCAAATTTATGCAGGCCATTAACATTCCTTGCTCTAATCATGTCGACTATTTGCATCATGTATG TGAACTTTGTTGTCATAGCCGAGGATGACATTACATAATTCCATAACACATTTATGAGCCTACTTACAAAAATATGTGCT TATTACTTGAATTTTATTTGCTATGTACATACATATTGGAACCACATTGGATTTGTCAATACTTAGATGGCAAAAAGGAG AGATAAAGATGTTAATTGGAGCCCAGAAGTTGAGGAACAGTTGCTTAGGCTTCTTGGTGAATTCAATTTGTTAAGCTCGG CTAGTAACGCACCAAACCGAGACAAATACATGCAATGGGCAACCGTGCTAAGTAGCCATTTTAGTGTCCTAGTTAGTTGG GATAAAGTTAAACAAAAAGCGGGTCAGTTGAAAAGAACTTTCGATGCAGAGTTCTTACTTCGGAATACAACTGGACTTGG CTAGGATCCAATTAAGAAGAAACCCATATGCACAGAGGAATATTGGCAACAATTTATCACTGTAAGTTCATTGTTTGAAT TCCTGCTAACTTTAAAGAGTCATTGATGTTTAATTTAGTTAAGCTTTGTTAATTGATATGCAGAGCCACCCTGAGGTTGA AAAAGCAAGGAAGAAGCCGTTAGCGGACTATAATTTGTATTACTTTGCGTTTGCAAATACACCTGCTACAGGTACACATG AGTACGGACAAGACGAAATCCCTACAAGTCCACCGCACCCACCAGAAAACCTTCCGAACAACCCTATTGACGTTGACGGT GGACAGTCCCAGTTCAATGAGTTTGGCGATACTTCATTCACAGAGATGAGAAAAGCTTTACACCAGACGGACCGAGTACC ACATCTTGGCTCACAATCACGTTTAATTAGTAAATGGTCAAGCAGAAACAGTCATACACGCTCACCAAGTTTCATAGAGC GTGCTGTGGATCGACTCGTTTCGTCTATTGAACAAAACAATCGCAGCCGAGGTAAAAGTTCCACAACGCCCAACTCAGTT AAGCAAGAAACCTATGAGGACAAATGCATTGATCTACTGGGAGAATTGGAAATACCTCAGGATCAATAGCTATTTATGTT TAACTTTTTGACCTCACATGTTACACTGCATCGACCTTTTTTGCGCATGAAAGAACACCACAGGTTGGTGTGGATTAAAC AGACAATGGATTCACATGCAAATCAACAATTCCATCCGCCACCACCACCACCGCAAATGCATGCCCCGCCTGGTCATTTT CAGGCTAACATGCCACTAAACCCCCAGTCCTCTCATACCTTTCACCCCAACTTCCATCCGACCGGTTCTACTTTTCAACC ATACAATCCCTCAAACTTTTCACCCTTTTTCTGGGCGACATGGGGGAGATGGTAGTTCACATCCGAACCAGTAAAATCCG ACCTTGTTGCAATATTGTTTTAGTTGGTTCGTTATTTAATTCAGAACATGCACTGGTCTTCTAAGATTTGGACATTGCTA TTGTTATGTAATTTATAGGCAATCTTTTGCTATCATGTCCAATTTTGGTAAATTTGAGGACCTCTGAAATAGTTATTTAT GAGAACATTGTTGTTTATGAGAACTTTTTTTTTCAATGTGTTGTTGTCTATCTTTCATATTGTTATATGTGAATGTCTCA TTTCTTTTACTCCACTGTAGGCTCCAATCAAATTCATTGACTATTGTATAGTGTTATAGGTTAATCTATTTTCTAGGCAT GAATTCAGACGGTCTTTCAAGTCCAACGAGCACTACAGACTCTGATTCAAGTCCAACGACCCCAACAGTCTCCGATTACA ATAGTGACGACAAATTTTTCAAGCAAGTGTATATAGCTATGGCGTTATTATGTATTGGATTTGTGCACAGAGAACCATCA CGCTGAAGGCACACTTCTGGCTGGGGAGGTAGGATTAGGGTGGACTATCATCTCAGAGGTTCTACATATGTGATTTATGA TAAAAATTTGGATGAGTGCTGATGCATTTGTGCGCCTCAGTTCTATCCTTGAGGAAATGAGATTATTGCAACCGACTGTC CACTTAAATGTTAATGAGTAACTACTCATATTCCTAACTATATTGTGTCAGAACCAAACAAACAGGGAGGCGCAAGACCA TTGGCAGCACTCGGGGTCCACAATATCGGATTATTTCACACAAGTTCTTGAAGCGATTTGCCATTTGAAGATAGACTTCA TAAGACATCCAAGTTACGATACGGTCCACCCTCACATAATTGCTAGTGGAAACAAGTACTTGCCGTGGTTCGACGTAAGT TAGTTGCTCTAAGTAAATTTATGTAGGGATTATCATAAAACATCATACACCAACTGACATAATTTTGAAATTATGAAGGA TTGTGTTGGAGCACTAGACGAGACGCACGTCCCATGTGTGCCTCCCCGTGAAACGGCCAAACTTTATAGAAATAGAAAGG GGTTCTTTTCACAGAATGTGCTCGCAGTGTGCTCATTTGATATGAAATTTACATACATGCTATCTGGCTGGGAGGGTTCG GCGCACGATGCGAAAGTACTTGCATCCGCCTTAGAACACCCGAGGAAACGATTTCCAAAGTCGCCACCAGGTTAGGGAAC GACCGTCTAATTCTAATTACCACATAATAATGTTATATGATTATTTATTAATTTTGATTACTATACATGTAGGAAAATTT TACCTCGTCGACTCAGGTTATGCTAACAACAGATGCTTCATGGCACCATATCGGGGGACAACGTACCATCTGCAAGAATA TAGGAATCGACGTGGCACAGGCTTCCGAAGTGAACGTGAACTGTTCAACTACACACACTCCTCACTACGTAATGTCATTG AAAGAATATTTGGTGTGTGGAAAGTCATGTTTCGTATTTTGAAAAGCATTAACCGACACCCTATGCAAAAGTAAGTTAAT ATTCTAGTTGCATGTGCCATGGTCCATAATTTCATCCACATGTACCGTAATGGAGACACCTTATTGGATCAGTATTCACA AGATGTCGTTGATCCCCAGAATATTGAAGAGGACATCAACGACAATAACAACCATCAGGGACAACCATTGAATTATAATG CAGAAGTAGAGATGAATGTCTTAAGAGATGCAAGGGCACATACAATGTGGACAGTGTACCGTAACCATCATACGCGTTAA AATTTCCTTCATAAGATGTCGATGTGCTAGGAGATGATTTTACATGGTGTATGTAGACATGTGTTATAAATTATGTATTT ATTGTTGTCCTTTAACTCTCCATTATAAATGATATATTTTTATGTTTGGTATTTTGAAACTTATTGCTACTTATAGATGA TTCACGTTTATTTATATATTTTTTTAATTGCCAATTTACCCATTCTTCATAGTTATATATATATATATATATATATAATT CTAATTATTTATATTCAATTGCATAAAATTAATTACGTAAAAAAAAGTAAAAAAAAAATTTATACTATTCACAACTCAAG TCTTAGTAGAAACAAACACAAACTCAAAAAGATTCTCATATCAAATTATAACTCAAATGTATACAGTCAAACACAAACTC AAGTTACAATTTAAACTCAAATTACAACTTAAACTCAAGTTATAACTTAAACTCAACTCAAAATTTACACTCAAATTACC TTAATTCAAAAATTGCAAAGGAACAAGCCC >DTH_5_2_Mno length=5447;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGCCCTGTTCGGTTGCTGCAGATTACTCGAGAAAGGCCCACTCGAGAGCCAAACTTGGCCCAAGTTCGCGTTCAGCGTGT CAAAACTCAAAAATTAATTCGAGTTACCTACCTTGTTTTGAGTTCATCTTCCCACTGCAACTTAAGTTAACTTCTCTGTA TTTCTACAGTGAAGATTCCTGCCCTATTGACTGTTGCTTGCTTTGTCCATCTCTTTTAGCTCTAACACGCCATTCTGCAA TTTAACGTGGTTCTCTGTAAGTGTGCCGTTGCCTGCTTTATCCCGTGAGATTCCTGTGAGTTCTGGCTGCCTTTTGACCC CTTCAAGCTTCAATTCCACTCCTTCAAGTTTCAATTCCGTCCCATACCCATAACTCAAATGCAAATCCATTTTTCCTCAA TCTGAGATAGAAAATCCCTAGCCCCAAAATTCACCCCTCATCTGTCCGCTTGGTCTCCGTTCAAGACGGAGAAATTCGGT GGTAGAAATCGATCTCTTCGGCAACCTCCTTGGGCAACCATCCTAGCTCGATGTAGAAGGAAAGGGTCTCGACCTAGTGC TTTCAAGTGGCGACATCAAAGCTACTTTCCCCTCCATTGTAGTCGCCGGTACCTCACTCAGGGTAAATCGTCTTTGCGTT TTGGGAATCTCGGAGCAGATCCAACTTACTCCTCTGTAGGCTCAAACTTAGTAAGCACTCGAATCCTTAGTTTAATTCCC TCGTCGTGTTCTGTCATTGTTTGAGTTTACTTCCATAAACTTAGCGATTGTAGAGCTGTGAAGTTGGCTTGTTTTTCTGT GATATGGATTGCTGAGATTGTGACTTGCTTGTGAGTTGCTGAGATTGTGTTATTGTGACTTGCTGTGTTATTGTGGCTTG CTGGGATTGTGTTATCTGGCTGAAAAAATATAATAAAGTTGTGGATATTAGTTTCATGATGTACTGAAAATCACAGGGGA AGAATGAAGAAAGCTCAAAGATTAGTCTGATGTAGAGGTTATGCTTTGTGCCGTGATTATATGTTCTTTGGCCAAGATTA AAGTTTTAACCAAAAAAAAAAAAAAAACCCCACATGAAAAGGCCGAGTTGGGTGGATTGATATGTAATATTGGGGAAATA GTTTTCAGTTGAAAAATGGTTCATCTGGGCTGTCGTGTTGTTCATCTGGGCAGAATTGCTTATCTTCCGTTTGTGTTTAG ATGAAATATGTGTATCTCGCCGCTTTAATTGTTGGAAATTAGGACGAAGAACTAATGTAATTCTTTCACTTTCTCAGCAA CCAAACAGAGCATAAACTGTTTTCCAGTGTACCTCAAATACTGATCAGCGATTGTAAGATTGTTTCTTTTCCTAAGATAG TTGTTTTAAAGGATTGTTATGTTGAAAGAGTTAAATATTTTTTTTCCTGGCCTGTTTGGCTATCGAGAAAATACGTATAT GAGTATAAAAAGAAAAAAAAAGCTTGGAATACTGATTCTTTTCTTTCTAAAACCAGAATATACTGGCTATATCTACTCTT TGCTGGTTTGGGTAACTATATCAATATTTATTCTTAACAATTAAAATTGACACAGAATAGAAAGTTCAAAATATTGTCTT GTTTTGTTTTGTTTTTTTCTTTTTCAAAATCATTAATTCTATCGGTAACCCAAGTAGGAGCATGATACAAGATGCATAAT TATGTTTGTGGTTGTAATGTATTCATTATTGTCTAATCAAATTTATGTAGGCCATTATCATTCCTTGCTCTGATCACGCC GACTATTTGCCAATTAATACATAAATTAACAGAACTTTAGTCATTTTTGCATCATGTGTGTGAACTTAGTTGTCATAGCC TGGGATGACATTCCATAAGGGGACGATGAGGGCCATAACACATTTATGAGCCTACTTACAAAAATCTGCGCTTATTACTT GATTTTTATTTGCTATGTACATGCGTATTGCTGCCACATTGGATTTGTCAATACTTAGATGGCAAGAAGGAGAGATAAAG ATGTTAATTGGAGCCCAGTAACTGAGGAACAGTTGCTTAGGCTTCTTGGTGAATTCAATTTGTTAAGCTCGGCTGGTAAC GCACCAAACCGAGACAAATACATGCAATGGGCGACCGTGCTAAGTAGCCATTTTAGCGTCCCAGTTAGTTGGGATAAAGT TAAACAAAAAGCAGGTCGGTTGAAAAGAACTTTCGACGCAGAGTTCCTACTTCGGAATGCAACTGGACTTGGTTGGGATC CAATTGAGAAGAAACCCACATGCACAGAGGAATATTGGCACTATTTATCAGTGTAAGTTCATTGTTTGAATTCCTGCTAA CTTTAAAGAGTCATTGATGTTCAATTTTGTTAAGCTTTGTTAATTGATATGCAGAACCACCCTGAGGTTGAAAACGCAAG GAAGAAGCCTTTAGGGGACTATGATTTGTATTACTATGCGTTTGCAAATACACGTGCTACAGGTGCACATGAGTACGGGC AAGAAGAACCCTGCAAGTCCACCGCACCCACCAGAGAACCTTCCGGGCAGCCCCATTGACATTGACGGTGGACAGTCCCA GTTCAATGAGTTTGGTGATACTTCATTCACAGAGATGAGACAAGCTTTACACCAGACTGGTCGAGTATCACATCTTGCCT CACAATCACGTTTAATTAGTAAACGGTCAAGCAGAAACAGTCATACACGCTCACCAACTTTCATGGAGCGTGTCGTGGAT CGCCTCGTTTCGTCTATTGAACAAAACAATCGCAGCCGAGGTAAAAGTTCCGCAATGCCCAACTCAGTTGAGCAAGAAAC CTATGAGGACAAATGCATTGATTTACTGAGAGAATTGGAAATACCTCAGCATCAATATCTTTTCATGTTCAACTTTCTGA CCTCACATGTTACACTGCAGCGGCCTTTTTTGCGCATGAAAGAACACCACAGGTTGGTGTGGATTAAACAGACAATGGAT TCACATGCAAATCAACAATTTTATCTGCCGCCACCACCACCGCAAATGCATGCCCGCCTGGTCATTTTCAGTCTAACACG CCACTAAACCCCCAGTCCCCTTATACCTTTCACCCTTACTTTAACCCGACCAGTTCTACTTTTCAACCATACAATCCCTC AAACTTTTCACCCGTTTCTGGGCAACATGGGGGAGATGGTAGTTCACATCCAAACTTTTCACCCTTGTTTATGACATTGT TGCAATATTGTTGTAGTTGGTTCGTTATTTAATTCAGAACATGCACTAGTCTTCTAAGATTTAGACATTGCTATTGTTAT GTGGTTTTTAGGCAATTTTCTGCTATCAGGTCCAATTTTGGTAAATTTTGAGGACCTCTGAAATAGTTATTTATGAAAGC ATTGTTGTTGTGTAATGACAATTCATTTTTTTTTCCTCAATGTGTTGTTGTCTATCTTTCCTATTGTTATATGTGAATGT CTCATTTCTTTTATATGTGACTATATTATGGGTCACACAGACACGTCATTGACTATTGTTTAGTGTTATAAGTTAATCTA TTTGCCAGGCATGGATTCAGACGATATTTCAAGTCCAACGAGCACTACAGACTCCGATTCAAGTCCAATGACCCCAACAG TCTTTGATGACGACGAATTTTTCAGGCAAGTGTATATAGCTATGGCGTTATTATGTATTGGATTTGTGTACAGAGAACCA TCATGCCGGAGGCACACTTCTGGCTGGGGAGGTAGGATTAGGGTGCACTATTATCTCGGAGGTTCTGCATATGTGATTTA TGATAAAATTCGAATGAGTGGTGACGCATTTGTGCGCCTCTTTGTTCTATCCTTGAGGAAATGAGATTATTGCAACCGAC TGTCCACTTAAGTGTTAACTAGCAACTATTCATATTCCTAACTATATTGTGTCAGAACCAAACAAAAAGGGAGGCGCAAG ACCTTTGGTTGCACTCGGGCTCCACAGTATCGGATTATTTCACAAAAGTTATTGAAGCGGTTTGCCATTTGAAGACAGAC TTCATAAGACATCCCGATTATGATACGATCCACCTTCACATAATTGCTAGTGGAAACAAGTACTCGTTGTGGTTCGACAT AAGTTAGTTGCTCTAAGTAAATTTATGTAGGGATTATCATAAAACATCATACACCAACATACATAATTTTGAAATTATGA AGGATTGTGTAGGAGCACTAGACGGGATGCATGTCCCATGTGTGCCTTCCCGTAAAACGGCCGAACTTTACAGAAATGGA AAGGGGCTCTTTTCGCAAAATGTGCTCGCAGTGTGCTCATTTAATATGAAATTTACATACATGCTATCTGGCTGGGAGGG TTCGACGCACGAAAGTACTTGCATCCGCCTTAGAACACCCGAGGAAACGATTTCTGAAGCCGCTATCAGATTAGGGAACA ACCGTCTATTTCTAATTAAGCTAACATCCCATATAATAATGTTATATGATTATTTATTAATTTTGATTACTATACATGTA GGAAAGTTTTACCTCGTCGACTCGGGTTATGCTAACAACAGATGCTTCATGGCACCATACTAGAGGATAACGTACCATCT GCAAGAATATAGGAATCGACGTGGTAGGCTTCTGAAGTGAAAGTGAACTGTTCAACTACACACACTCCTCACTGTGTAAT GTCATTGAAAGAACATTTGGTGTATGGAATGCCAGGTTTCGTATTTTGAAAAGCATTAACCGATACCCCATGCAAAAGCA AGTTAAGATTTCAGTTGCACGTGCCGTGGTCCATAATTTTATCCACATGTTCCGTAATGGAGACACCTTATTGGGTTAGT ACTCACAAGATGTCGTTCCGGTTGCTGACATTGATCCCCAAAATGTTGAAGAGGACATCAACGATAATAACAACCATCAG GGACAACTATTAAATTATGATGTAGAAGTGGAGATTAATGTCTTAAGAGATGTAAGGGTACATACAATGTGGGCAGTGTA CCTTAACCGTCGTACACGTTAAAATTTCCTTCATAAGATATCGACGTGCTAGGAGATGATTTTACATGGTGTATGTAGAC ATATGTTATAAATTATGTATTTATTGTTGTCCTTTTACTTTCCATTATAAATGATATATTTTTATGTTTGGCATTTTGAA ACTTGTTACTTATTGATGATTCACTTTTATTTATATATTTTTTAATTGCCAGTTTACCTATTCTTCATAATTATATATAT TTAATTCTAATTATTCATATTCAATTGCATAAAATTAATTAAGTAAAACATTTTCTATGTTATTCACAACTCAAGTCTTA GTAGAAACAAACACAAACTCAAAAAGATTCTCATCTCAAATCATAACTCAAATGTACACAGTCAAACACAAACTCAAGTT ATAACTTAAACTCAAGTTATAATTCAAATTCAACTCAAGATCTACACTCAAATTATTCTAACTCAAAAACTATAAAAGAA CAAGCCC