>DTH_5N_1_Mno length=168;Class=DNA transposons;Order=MITE;superfamily=MITE; CTCTGGTGTTCTTTCTTTTTTAAAAACACTGGTGTTCTCTGTTTATCAGCCGTCAGATCTGTATTAAATCTGGTCAAAAG TCAAATCAGATTGAAAAAATAATACAAATCTGACGGCTGATAAGCAGGAAACACCAATGTTCTCAAAAAAGAGAGAACAC CAGAGAAA >DTH_5N_2_Mno length=161;Class=DNA transposons;Order=MITE;superfamily=MITE; TTAGAAACTTTCTCTGGTGTTTTTTCTTTTTTAAGAACACCGGTGTTTCTTACTTATCAGTCGTCAGATCTGTATTAAAT CTGATCAAAAGTCAAATCAGATTGAAAAAATAATACAGATCTGACGGTTGATAAGCAGAAAACACCAGTATTTTTAAAAA A