>DTH_4_1_Mno length=2390;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GATCCAACTACAAGTATTGAAACCTGTATGGATTTGCTGGATGGGTATGATGAGTATTTAGACGACAATGCGTATAGTAA GGCAACGCACCAGTTGGCTGTTGACATTTCCCTTAGGAGGATGTTTGTGAAAATACCCGCTCATCGTCATCTTTCATGGA TTCGAAGCCTGTAGTTTAAATGATTTTTGTGTTGTTTTCTTTATTTGTTTCCTCTCGGACGTATGTTTTTTTTTTAAGTA TTGTTGAGCATGTACAACAGATTTTCCTCTCGGACTTGTGTTTGTTAGACTTTGTTATTTGTTTCTAGTCAGATTGAATT ACATTGGAGTTCTTCGTTTGATTAGTTAATGTTATATGGATGTTTGATTAGTTCCAGTCTTATTCATTTTTTAGGTTTAT ATGGATTCAGATAGTGAGAATGATGCCAGAGCTGTTGACTTTCTCTAGTCATCAGATGATGATGAACAACCACAACATTA TATCCAATTATTGATGTCAATTGGAAACAGACGAACTAGGCAACCTCGTCGTAATTCTGCGTTAACAGGATGAGAATATG TTTTAGAACAATTACATGGACATCCCAAAAATTTGTTTGAAATATGTCATATGCATCGAGACACGTTCGAAGAAATTGTT CAGTTAATTCGAGGCCGCAACCTACTGCCTTCTTCAAGTATTTCAACAGAAGAATCTCTAATGATGTTCTTAAGAACGGT TGCTCACTCAGACCGCAATAGAGAGATACAAGATAGATTTTATCATTTTAGAGAGACAGTACACCGGCATTTTGATAATG TGCTTACCGCATTGTCTACGTTAGCACCTGAAGTTATAAAACTACCAAATATGAACATTGTCCCCCCAGAGATTCAACAC AACCCTAAGTACTGGCCATGGTTTAAGGTACAATCTCACTCTGCTCATAAACTACTACTATGACAAATACTTTTAAATTT ATCCTAACTCACGCCTTATGTATTTTAATAGGATTGTATTGGTGCAATAGGCGGTACACACATGATGGTTGTCCTACCTG CACATCAACAGACAGTCTATAGAGGAAGAAGACATTCGTGTACTCAAAATGTAATGGCGGCGTGTAGTTTTGATATGCTA TTCACTTATGTCAATTCCGGATGGGAAGGATAAGCTGCTGATTCCGGAGTGTTAACTGAGACTATGAGAGATCCAGATAA CCAATTCTTAGCGCCCAACACGCAAGGCTTTTTGGCACCATTTCGTGGTCAGAGGTACCATATTCAACAGTTTAGAAACG GTGGCCAACCAACGGGACCACAAGAGTTATTCAATTATTATCACTCTTCACTGCGTAATTGCATAGAGATGTGCTTTGGG GTCTTGAAAATAAGGTTTAAAATTCTTAGGCATATGACCAATTATTGGATGCCAAGACAAAATGTTATACCAATTATTGG TTGTGATGGTGATTCATTTGTAAGGAGATACCTAGAGCATGTGCTTGAATTCAAAGCAGAGAATATCCACAATGTTACTA AGGAATATGATTATGCGGCACAATTTACAAACAAAAACATAATTGCTGCCTTTCTTGAGCTCCCATACGAGAGAGTTTTT CTTAACAAGTACTGCAAGGAATTCACAACCACTACACCGACCTACAGATTTAGAGGATTGGGATTTGTGGGTATAGCTTT ACTTTATTCACTTTATACTCTTATCACTCTAAAGAAGTGAAGAAATGTTTTTAGAGTTTTGTCACATCTCTACCTTAAAC TTTTCAGGATTGACAAGTTACCTCGAACTTTTAATTCCGCCAAGTAATTACCTAAATTTAACAAAGTGTTCCGAGTGTCG TTGAATCAATAACACATGATAAATTTTGAATGGAAACACTATAGGACATGTTATGTCATATGTGAGCTCGTATGAAGGAA TAGACTAAAATTTTGGATAATAATCGGGTCATGTTATGTGACGTGCATGAGAGAATTTCTTTCAAAATTTTAACATTAAT CATCAATGTATGGGAACTTTGCAACATTTTATTAAATTCATGTGGTAATTTGCCAAAATTAGAAGTTCAAGAAGCAACTT CTTAATTGAGTCAAAATTCAAAGGAAAAATCACAAAAAAAAACAAAAAAAACAAAATCATATTATTACAATTGTCGTGGC ACATGCTCTTGTACCTATTATTCATTACTATGAAAATTTGTAGTACGTATGAAACAAGCACGAGTGGTCTAGTGGTAGAA TAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAAAGAGAGCCATGATGACTCTTGCGCCTTTGTG ATGGTGGGGTCCATCACATCACCTGATCCAACGGACGAGAAATGGGCGCTTCTGAGCTCTTGAAAATTTT >DTH_4_2_Mno length=2382;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; CGTTGGGGCTGATACAGCCCCTGGGGGCCTCCCATTAGGGCTGACCTGGGAGGCCCCCAATAGGGGCTGAAAATCAGCTG ATAATCAGCCCCCATCAGCCCTAATGGGGGCTGATAATCAGCCTTGATGGGGGTTGATTACAGCCCCCATCAGCCCTAAT AGGGGCTGATTATCAGCCCTCATCAGCCCCAATAGGCGCTGCTGATAATCAGCCCTGATGGGGGCTGATAATCAACCCCC ATCCGCCCCAATGGGGGCTAATTATCAACCCCCATCAGCCCCAACGGGGGCCTCCCAGGGACTGAATCAGCCCCAATGGG AGGCCTCCATGGAGACTGTATCAGCCCCTGCGTGTGTGTGTGTATATACTTTACAAATTGACATTTATTTTAATGATGAA AGTATTATTTTAGATGTGTGATAAGGACGATAATACGAAATGGCCGGCCGCAATTGACTTTCTCCAGTCATCAGATGATG ATGAACAACTACAACATTATATCCAATTATTGATGTCGATTGGAAACAGACGAACTAGGCAACCTCGTCGTAATTTTACG TTAACAGGACGAGAATATGTTTTAGAACAATTACATGGACATCCCAAAAATTTGTTTGAAATGTGTCGTATGCATCGAGA CACGTTCGAAGCAATTGTTCAGTTAATTCGAGACCGCAATCTATTGCCTTCTTCAAGTATTTCCGTAGAAGAATCTCTAA TGCTCACTCAGATCGCAATAGAGAGATACAAGATAAATTTTGTCATTCTGGAGAGACAGTACACCGGCATTTTGATAATA TGCTTACCACATTGTCTGCGTTAGCACCTCAAGTTATAAAACTACCAAATATGAACATTGTCCCCTCAGAGATTCAACAC AACCCTAAGTACTGACAATGGTTTAAGGTACAATCTGACTCTGCTCATATACTACTAATATGACAAAAAATTTTAAATTA ATCGTAACTCACGCCTTATGTATTTTAATAGGATTGTATTGGTGCAATAGACGATACACACATGATGGTTGTCCCACCTG CACATCAACAGATAGTCTACAGAGGAAGAAGACATTCGTGCACTCAAAATGTAATGGCGGCGTGTAGTTTTGATATGCTA TTCACTTATGTCAATACCGGATGGGAAGGATCACCATTCTTGGCGCCCCCCCCAAAAAAAATATTACGTTGTGGATTCCG GTTACAGCAACACGCCCGGCTTTTTGGCACCATTTCGTGGTCAGAGGTACCATATTCAACAGTTTAGAAATGGTGGTCAA CTAACGGGACCACAAGAGTTATTCAATTATTATCACTCTTCACTGTGTAATTGCATAGAGAGGTGCTTTGGGATCTTAAA AGTAAGGTTTAAAATTCTTAGGCATATAACCAATTATTGGATGCCAAGACAAAATGTTATACCAATAGCTTGTTGTGTGA TCCACAATTTAATTAAGATGCACGCGCGAGATGATCCTCTATTTAGACAATATGAGGTTAATTTGCCAGTAGAAGATATT GAGGGAGAACAAGAAGGGCAACAGGAACAACAACATGGTATGGATGCACAAGAAGCAGAAACATATGAAATGGGTGGTCG ACAACAACGTAATTACATGGTTAATTTTAGAGATCATCTAGCTAATCAAATGTGAGATTCATATAGGCGACAATAATTTA AGCTAATATTGTAATTTTCATATTTTATTAATTATTAGTGTTTTTATTTGTGATTCAATTATTATTTATTTAATAAATTA AATACTATTACATGTTTTCAAAAATGAAACTACCAAACGCAGTTTCAGTTTTTTTTAAAACTGAAATCAATCTCTAAATA AAACTACTAAATGCATTTTCAGAAATAATTCAAAAATGAAAATGAAAACGTTTTCATTTCCATTTTCGTACAGAAAATAA AAACATTTTGGAATCAATTCCAAACGCACCCTATATATTGCAGAATCCACTATAGTCATATGAAAGGTCATTAACCTAAT AGTCATTCATGTTGCAAATATAATTGATACTTCATACTTCATATTAAAGGTCTACCAGAAAGTAGGCAACTAATAGTCAT TCATGTTGCAAACATAATTGATACATGTATATGAAGTAATATTGCAGAATCCCATAACCAATTTGCACTTTCAATCGTGT CTCCCACGGCTTCTCTAGTATTCCACCCACATGTTATTCGCTAGGCGATCCCTAAAACGACCCATCTCCGTTCGGCTAAC AGTAGCTCATGTTACAGTTGGCCCCTCAGGGACATTGTCGCCATTGTCATCGTCATCCATCTCGTCAATATTGGTTAGAT CTATTTCACTAACCGGTACTGCATCACGGTAGTATTGATTTAGAAGCGGGTCCCCCTCATTT >DTH_4_3_Mno length=2377;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TATTTGTTTCCTCTCGGACGTATGGTTTTTTTTTAAGTATTGTTGAGCATGTACAACAGATTTTCCTCTTGGACAAGTGT TTGTTAGAGTTTGTTATTTGTTTTTAGTCGGATTGAATTACATTGGAGTTATTCGTTTGATTAGTTAATGTTATATGGAT GTTTGATTAGTTCCAGTCTTGGTTCATTTTTTAGGTTAATATGGATTCAGATAGTGAGAATGATGCTAGAGCTGTTGACT TTCTCCAGTCATCAGATGATGATGAACAACAACAACATTATATCCAATTATTGATGTCGATTGGAAACAGACAAACTGGG CAACCTCGTCATAATTCTGCGTTAACAGGACGAGAATATGTTTTAGAACAATTACATGGACATCCCGAAAATTTGTTTGA AATGTGTCGTATGCATCGAGACACGTTCGAAGCAATTGTTCAGTTAATTCGAGGCCGCAATCTACTGCCTACTTCAAGTA TTTCAGCAGAAGAATCTCTAATGATGTTCTTAAAACTGGGCAACCTCGTCATAATTCTGCGTTAACAGGACGAGAATATG TTTTAGAACAATTACATGGACATCCCGAAAATTTGTTTGAAATGTGTCGTATGCATCGAGACACGTTCGAAGCAATTGTT CAGTTAATTCGAGGCCGCAATCTACTGCCTACTTCAAGTATTTCAGCAGAAGAATCTCTAATGATGTTCTTAAGAACGGT TGCTCACTCAGATCGCAATAGAGAGATACAAGATAGATTTTGTCATTCTGGAGAGACAGTACACCGGCATTTTAATAATA TACTTACCGCATTGTCTGCGTTAGCACCTCAAGTTATAAAACTACCAAATATGAACATTGTCCCCCCAGAGATTCGACAC AACCCTAAGTACTGGCCATGGTTTAAGGTACAATCTGACTCTCATCAGATACTACTAATATGACAAATAATTTTAAATTA ATCGTAACTCACGCCTTATGTATTTTAATAGGATTGTATTGGTGCAATAGACGGTACACACATGATGGTTGTCCCACCTG CACATCAACAGACAGTCTACAGAGGAAGAAGACATTCATGCACTCAAAATGTAATGGCGGCGTGTAGTTTTGATATGCTA TTCACTTATGTCAATACCGGATGGGAAGGATCAGCTGCTGATTCCAGAGTGTTAACTGAGACTATGAGAGATCCAGATGA CCCATTCTTTGCGCCTTTTTGGCACCATTTCGCGGTCAGAGGTACCATATTCAACAGTTTAGAAATGGTAGTCAACCAAC GGGGCCACAAGAGTTATTCAATTATTATCACTCTTCACTGTGTAATTGCATAGAGAGGTGCTTTGGGGTCTTGAAAGCAA GGTTTAAAATTCTTAGGCATATGACCAATTATTGGATGCCAAGACAAAATGTTATACCAATAGCTTGTTATGTGATCCAC AATTTAATTAAGATGCACGCGCGAGATGATCCTCTATTTAGACAATATGAGGTCGATTTGCCCGTAGAAGATATTGAGGG AGAACAAGAAGGGCAACAGGAACAACAACATGGTATGGATGCACAAGAAGCAGAAACATCTGAAATGGGTGGTCGGCAAC AACGTAATTACATGGTTAATTTTAGGGATCATCTAGCTAATCAAATGTGGGATTCGTATAGGCGACAATAATTTAAGCTA ATATTGTAATTTCCATATTTTATTAATTATTAGTGTTTTTATTTGTGATTCAATTATTATTTATTTAATATATTAAATAC ATGTTTTCAAAAATGAAACCACCAAACGTAGTTTCAGTTTTTTTTTAAAACTGAAATCAATCTCTAAATAAAACTACCAA ACGCATTTTCAGAAATAATTCAAAAATGAAAATGAAAACGTTTTCATTTTCATTTTCGTACAGAAAACAAAAACGTTTTG GAATCAATTCCAAACGCACCCATAAGGTTTCCCTTTTGCGGGTAGGGCTAGGGTTGGGATTCAAATCCCAAAATTTACTC CCTGTTGAGGATTTTACGCCGTGCTCTTTGTAAATATATTTTCTTAAAAAAATAATTTGTAGGTTCTAATTATTACAATT ATGCAAAGATAATGATGAACTCAAATATAAATAAATGCAAATACATATAATTAGTTAATTTTTTTCATCTAATTATGCAT GTTATAGATACACACTAGTTGAACTCCACGTGAAAAGCACGTGGAAAGTAATCTGTTAAGTTATAATTAACTAATTATCA TGTTATTATTAAAAACATATAAAATCTGAATATAAACCAAAATAAGAAACAAATAAGTTTTAAGGCAAGAAGCCAAGATA AAGCCAAAAAAATGACTAAAATGAATAATTAAATATCATTTTAGGGCAAAAGAAACC >DTH_4_4_Mno length=2372;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AGGATTCTCATTGGTTTCTATCACATTTTCTCCATACCTATGGAATATGGAAATATTATATTCAGACAATCACCGAGATT CATTGAGGCAGTTGGCGGTTGACATTTCCCTTAGAAGGATATTTGTGAAAATGTCCGTTTGTCGTCATCTTTCATGGATT CGAAGCCTGTAGTTTAAATGATTATTGTATTGTTTTCTTTATTTGTTTCCTCTCGAACGTATGTTTTTTTTTTAAGTATT GTTGAACATGTACAACAGATTCCTCTTAGACTTGTGTTTGTTAGACTTTGTTATTTGTTTTTAGTCGGATTGAATTACAT TGGAGTTCTTCGTTTGATTAGTTAATGTTATATGGATGTTTGATTAGTTCCAGTCTTGGTTCATTTTTTAGATTAATATG GATTCAGATAGTGAGAATGATGCCAGAGCTGTTGACTTTCTCCAGTTATCAGATGATGATGAACAACCACAACATTATAT CCAATTATTGATGTCGATTGGAAATAGACGAACTAGGCAACCTCATCGTAATTCTGCGTTAACAGGACGAGAATATGTTT TAGAACAATTACATGGACATCCCGAAAATTTGTTTGAAATGTGTCATATGCATCGAGACACGTTCGAAGCAATTGTTCAG TTAATTCGAGGCCGCAATCTACTGCCTTCTTCAAGTATTTCAGCAGAAAAATCTCTAATGATGTTCTTAAGAACGGTTGC TCACTCAGATCGCAATAGAGAGATACAAGATAGATTTTGTCATTCTGGAGAGACAGTACACCGGCATTTTGATAATATGC TTACCCCATTGTCTGCGTTAGAACCTCAAGTTATAAAACTACCAAATATGAACATTGTCCCCCCAGAGATTCAACACAAC CCTAAGTATTGGCCATGGTTTAAGGTACAATCTGACTCTGCTCATATAGTACTAATATGACAAATAATTTTAAATTAATC GTAACTCACGCCTTATGTATTTTAATAGGATTGTATTAGTGCAATAGATGGTACACACATGATGGTTATCCCACCTGCAC ATCAACAGACAGTCTACAAAGGAAGAAGACATTCGTGCACTCAAAATGTAATGGCGGCCTGTAGTTTTGATATTCTATTC ACTTATGTCAATACCGGATGAGAATGATCAGCTGCTGATTCTAGAGTGTTAACTGAGACTATGAGAAATCCAGATGACCC ATTCTTGGCACCTTTAACACCATTTCGTGGTCAGAGGTACCATATTCAACAGTTTAAAAATAGTGGTCAACCAACAGGAC CACAAGAGTTATTCAATTATTATCACTCTTCACTGCGTAATTGCATAGAGAGGTGCTTTGGGGTCTTGAAAGTAAGGTTT AAAATTCTTAGGCATATGACCAATTATTGGATGCCAAGACAAAATGTTATACTAAAAGCTTGTTGTGGGATCCACAATTT AATTACTATGCACGCGCGAGATGATCCTCTATTTAAGGGCAACAGGAACAACAACATGGTATGGATGCACAAGAAGCAGA AACATCTGAAATGGGTGATCGGTAACAACGTAATTACATGGTTAATTTTAGGGATCATCTAACTAATCAAATGTGGGATT CGTATAGGCGACAATAATTTAAACTAATATTGTAATTTCCATATTTTATTAATTATTAGTGTTTTTATTTGTGATTCAAT TATTATTTATTTAATATATTAAATACTATTACATGTTTTCAAAAATGAAACCACCAAACGCAGTTTCAGTTTTTTTTAAA ACTGAAATCAATCTCTAAATAAAACTATCAAACGCATTTTTAAAAATAATTCAAAAATGAAAATGAAAACGTTTTCATTT ACATTTTCGTACAGAAAACAAAAACGTTTTAGAATCAATTCCAAATGCACCCAACATTACTATCTTGGAAACCATAAGTC ATTTTTAAGTATATGTCAATAAACAACAGTCATGTAGATTTATTATGAATAAATAATAATTATATGAATAATATTGAAAG ACAAATCAATAAACCATTCATTTTTAATATGATTGTAGCAGATAAAACCTCACCAATTACCTAGAATAAAGCACTCAGAC ATGTTAAAAGATTGATGTTTCAATGGAATAAAAACTTAAAAGGGATATAATAGTAAAAGAAAATGTTGGGATTTCGCAAG AGCCAGTCTATCAAAATTCTGTTTTTCCTTCAATGGAGATGTTGGAACATAAAGACTACCAAATATAACAAGGAATTAGC TTGTGCAAAAATGGGCCACATTGGAGGCTGACATTATATACATGTATGCAAACGCTATTCTGTCATTGACAAAATGAGCA GTCAGAAGTTTTGTGACTAAGAAGCCATTGAAAGAGTCAACATCAAAAAGCT