>DTH_4N_1_Mno length=109;Class=DNA transposons;Order=MITE;superfamily=MITE; ACAACTCAAGTCATAACTCAAGTTTTTTATGTGAGAGAAAAATACTGTAATAAAAAAGTTAAATTTAAATTTTTGTGAGA GAAAACACTGTAGTAATATAACTTGAGTT >DTH_4N_2_Mno length=141;Class=DNA transposons;Order=MITE;superfamily=MITE; TCACAACTCAAGTCACAACTCAAGTTTTATTGTTACAGTATTTTCTCTCATAAAAATTTAAATTTAACTTTTTTATTACA GTATTTTTCTCTCACATACACAACTCAAGTCATAACTCAAGTTATGACTTGAGTTGTGAAA >DTH_4N_3_Mno length=126;Class=DNA transposons;Order=MITE;superfamily=MITE; TCACAACTCAAGTTAAGAACTTGAGTTGTGTATGTGAGAGAAAAACACTGTAGCAAAAAAGTTGAATTTGAATTTTTGTG AGAGAAAACACTGTAGCAATAGAACTTGAGTTGTGAAAAAAACAAG >DTH_4N_4_Mno length=153;Class=DNA transposons;Order=MITE;superfamily=MITE; TATGTTTGTTTCACAACTCAAGTTAAGAACTTGAGTTGTGTATGTGAGAGAAAAATATTGTAGTAAAAAAGTTAAATTTA AATTTTTATGAGAGAAAATACTGTAATAATAAAACTTGAATTGTGACTTGAGTTGTGAAAAGAACAAGACCTT >DTH_4N_5_Mno length=136;Class=DNA transposons;Order=MITE;superfamily=MITE; ATGTTCTTTTCACAACTCGAATCACAACTCAAATTTTTTGCTACAGTGTTTTCTCTCATAAAAATTCAAATTTAACTTTT TTACTATAGTATTTTTTCTCACATAAAATTCACTTTTCAACTCAAGTTCTCAATCA >DTH_4N_6_Mno length=106;Class=DNA transposons;Order=MITE;superfamily=MITE; AGAACTTGAGTTAAAAAGTGAATTCATGTGAGAGAAAATATTGTAACAGAAAAAGTTGAATTTGAATTTTTATGAGAGAA AATACTGTAATAAAAACTTGAGTTGT