>DTH_31_1_Mno length=1877;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; ACTTGTATTGTTTGCTTGTATTAGGACAAACTTATGTTGTTTGCATGTTTTATCCGGCACATTCGAATAATATGCGTCGC TTTGAATTGTTTTTATCTATAGTATTTGCAAGTTACTAATTATATATCATAGAGGATGTTGATTCTTGATTGTATACATG TTTGTTCTTTGTTATTGTTAGGATGGACACTTCCAAATCCAGAGGTCCAGGTCAAAATAAAAGGTTTTGGAATGAAGATG ATGATAAATTCCTAATTGAGGCTTTAATGGAGTTACATAACGAGGGAACATATAAAGCGGAAGGTAATTTCAAGGCTGGA CATCTGCACGCTCTTGAGAAAAAGTTACATAGCAGGTTGTCAGGATGTGACTTACTAGCTAGGCCACACATAGAGTCAAG AATGAAAACTTTGAAGACTCATTTTCAAATTGTGCATGAAATGCTAACCGGGCCTAACTGTAGCGGTTTCGGATGGGATC CAGATAGAAAAACGGTTACAGCTGAGAAGCCGGTGTGAGAAGCATATCTCAAGGTACTTATAATATAATTCAATAATATG GTTGATAGTAATAGAAGTTGTTCATCTAGTTTAATCTTTTTTCTGTATTAAATTCAGAGTCACAAGGAAGCATTACCGTT TAAGACCAAGGCTTTTCCCTACTATGATGACTTGTGTATGGTTTTCGGCAAAGATCGTGCAACCGGTAGGGGTGCCGAGG CTGCTGCTGATGTAGTTGAGGAACTTGAAAAGGAAGNAGNTGACGACATTAATATTGACGATGACTGTTTCAATAGCATT CACAATACGACTTATGTGGATGAAGCGCAATCAATGTCTTTCTCACAAGCATCGGCTGTTCCTCAAACTCAAGCTCAATC TCAAGGGTCNTCTAAAAAAAAGGAAGAGTACAAACAATGCAGAGGCTTATGAAGCCATTGAAGAGTCATCTAGTTTACTT GCTGGTGTTATTGAAAAGGCANGTGAACGTTTAAGTCGGGCTATCGGTGAAGACATGATGGAAAAACATAGCCGGATTAG AGATGAGCTACAAAGGACCACAACCATTAACACAATGGAACGNCATAAGGTAGCTCGGATGATGATAAAAGATGATGCTT TAGTTTCNTACTTTTTTAGTATCCCTGATGATGAAAGAGATGAGTGGGCTAGAGCTTTNCTTGCTGGTGATATTTAGGAG TGNTTGTTTAGTTTCAGTGGAAAAACATAGCCGGATTATCTTTTGATATTGTAATGTATGTGCTATGCATTTCTCTTTTG ATATTGTAACTAATTAGGATTATGCTTCACTTTGTTAAATTGTATTAACTAGGAACTTGCTTGACTTGGCAGATGATGGA TGTTGTATATAGGTGAATCTACTAGTTTTGGTGTATGACTATATTTTGGGATTATATATGTAGTTGAATGATATATTATN TCATTTTTATTATTGACAGGGGCCAAAGTGATCATTTTACTCGATACATATCATGGTAGATGCCAAAAGTGATCATATTT GAGCTTGTGATAATTTATTATTACATAAAAATATCAAATATTATTTTTTTTACCATTGAAATATAGTTTTTAAATTTTAT CCTTCAAATAAAAAGTTTTTTTCAATAATTAAATTATTTTTTTACTATTTTAATTAATTAAATATTAAATTATTTAGGAT TATTAATCAAGGGTATTTTTGTCAAAATACAGTTTACTTTCATTCCATTCCGTTGTCAACCAAACAGCATAATCCTCATT CAGGTATTGATTCCATAACTCCAACCAAACTAAAGAATCAGTTTATGATTCCAGCACATTCTAATTTCATTCNATTACTA TTCTCATTACCATTCCGCCACTGCAACCAAACGCACC