>DTH_30_1_Mno length=2497;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; CGCCGACATCATATACGCCAACTAAATTACCATCGATTGATACATGAGAGTGACTTAGCATGTCTTGAAAGCACTCGTAT GGATAGGAGAACATTTACTATCCTATGTAACTACCTTAGAACCATTGGCNATTTGAGGGGAACAAAAAATATGGATGTTG AAGAATTGGTAGCTATATTCCTACATATATTAGCTCATGATAAAAAAAAATAGGATTATGAAACGCCTATTTGCACGCTC GGGTGAAACAATAAGTAGACAATTCAATATTGTCTTAAAAGCGGTGTTACGCCTCCATGAAGTATTACTAAAAAGGCTAG AGCCAGTTCCAGAAAATTCCACGGATGAAAGATGGAAATGGTTTAAGGTGAAAATTTTAAATATCTCTAATTTTTTATTA TTTGTATGTTAATATGCGGTAGGTATGTGGGCTTAAATTATTATTTGTGTTTTAGAACTGTTTGGGAGCACTTGATGGAA CATACATCAAGGCCAATGTATATATGCAGCGGACACGCCTAGGTACCGTTCCAGAAAGGGTGAAATTGCTACCGACATGT TGNGAGTATGCTCTCGAGATATGCAATTTATNTATGTATTGCCCGGATGGGAGGGTNCCGCANCTGACTCAAGAGTTTTA CGANATGCTTTATCTAGGAGGAATGGGTTGAAAGTTCCACAAGGTAAATATGTATCTTCTTGACAGTTATAGAGTCATAC ACATTAAAATGTGTATGCATTTTNATATTTTNTAATANATATCGAAATGATTTACATGATATTACTACCTATGCGATGCT GGTTANCCTAACGGTGAAGGCTTTTTGGCTCCTTATAGAGGACAACGCTACCATTTAAATAAATNGACATACCCNCCTGA GACTCCTGAAGAGTTTTTTAACATGAAACATTCCTCGACTAGGAACGTTATTGAGAGGACATTTGGACTTTTGAAGGGGC GATGGTCAATTCTNAGGGAAAAATCATTCTATCCGATCAATGTACAATGTAGGATTATTGCCGCATGTTGTATTCTTCAC AACTTAATTAGGAGGGAAATGGCTANTGATCCTTATGGAATGTACGATGGAATGATCCAGGACGACGATTGAAGACGAAA TATAGCATTACACACATATTGAAACATCCAACGCTTGGACTACATGGAGAAATAATTTGGCTAGGGAAATGTTTGACCGA ATGGCGAGNAAATCGCCATTAGGATTAATGGTTNATGTNTNGCANTGTTTTNTTATNATTCTTAATAAGTACGTATGCAT NTTTGTTGTTACTCTTAATAAGTATGTATGACATTGTTGTTGTAATTCTTAATAAAGATATATTGATATGTTGNTTTGTT TTATCTAGTATTGTTAGTTTTGTTTTCATATTAAAGTNTATAATTTGTACACAGAATGGATGCTAATGGAAGGAAGCATC AATGGACTGCATTGGAAGATTCAAAGCTAGTGGAGTGCTTGTTGGATATGGCTAATAGTGAAAAATGGAAAGCGGATAAT GGTACGTTCAAGCCCGGTTACTTGCNACAATTGGAGAAAATGATGAACGAAAAGATTCCACAATGTGGGCTTAAAGCACA ACCACACATTGATTCTCGTGTAAAGATATTGAAGAAACAATATCATGCCATTTCTGAAATGTTGGGCCCTGCCGGTAGTG GCTTTGGTTGGAATGATAAGGATAAATGCGTTATGGTTGAGAAAGATGTGTTTGATGAGTGGGTTAAGGTTAGTATTTTT TTAACCGGTTATAAATTTCAAGTTTCAGTATATTAGGCTCTTTTATTGTTTAATTTACATTCCATATNTATTACAGAGTC ACCCAACTGCGAAAGGCTTAAGAAACAAGCCGTTTCCTTATTATGATGAGTTAGGACTTGTGTTTGGAAAGGATCGTGCT AATGGACAAGGTGCAATGGGATTGANTGATATGGTTGATGACATTGATAAAGAAACAGAAAATGATCTTGATTATGATCC CTTGCTTATGTCTGATGAGNACATGGATACTGCAAGTATTGGTGGTCCTAGCACACAATCAACTTCAACACCATTAGCAT CAGGAAGGAAAAAGAGAAAGAGATCTCAANGTGGAGATGTATTGGTTGATGCTTTAACTGAGACAGTACAAAAGTTTTCT GATATGTATGCTATGGCTGGTGAGAATATTGGTAGGCTTGCTAATTGTTTTCAATACGAGGCTGATAGTGCTGCAAGGAG GATGCAGGTGTTTGATGAAGTGAAGAAGGTAGAAGGACTAACAAATGCACAACGAGTACGAGTCGGAAAACTTCTTGTCC AAAACCATGACTACACCAACTATTTCTTCACGTTGGATGATGAATTTAAGTTAGATTTTCTTCTATCTCTTTTGGAATGA GTTAGGTTGAAGCTTTTGGTGCTATATTTACAAACTTGAGTATATGGTCCAATATTTAGATCTTTTGATGGCATCTTTGG AACTTTTATATGTGGTC