>DTH_3_1_Mno length=8416;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GATCTTGTTCGTTTTGTGAATTTAAGTTGAGATGTGATATATTAAGAAGCTTTTAACTATAGTAAAAAAAAATTAAATAT AATATTTTTTAAGATTTTTTAATTATAAAAATTTTAAATTAAAATTTTAAATTAATAAAATGAATGAAATATAACTTTTT CTATTATAATTAAATAAAATTTAAAAAATATCACATTCCTAATTGAATTAAAAATAATTTACGAGTTGTTCTTTTGGATT GTAATTTGAGTGTAGTTTTTGAGTTGAATTTGAGTTATAACTTTAGTTAAAGTTGTAACTTGAATAAAGTTGAGTAAAGT TGAATAAAATTGAAACTTAAAAAAACGTAAATTTAAATAAAATTAAAACTCGAGCTGTCTTTTTTAAATTTTTTAGACAA AAAAACATGCCCTTAAATATGTGAATATAATTACGTACGGAGATTATGTATATAAGAATAAAAATTCTTTCGATATTTTA GGGTCCGTTTAGTTCGCTGATTCAAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGTAAAAAAGTTAGATGTG ATTATTTGTGAGAGCTTTTTACTGTAACAAAACTTGAATTCTAAACTCGAATCAGCGAAATGAACGGGGCCTAGGGACTT TTTATGCCATTCACACGTCTTTTATGTCGGACAAGCTTCCACACGCAAGAGATACCACGTGTCCAAGTAAGGGGGCGGCA TTGCCGGCGTTTGGTGAGCGAGGAGTGCCTTTTGCTCAAATAGAGAAGAATAATGTTATAGCGCAATAAGGTAAAATTTT ACGGCTGTGTGCAATTGTTTTTGGGTGCGTTTGGAATTGGTTCCAAAACGTTTTTATTTTCTATACGAAAATGAAAATGA AAACGTTTTTAGTTTTATTTTTGAATTATTTCTAAAAATGCGTTTGGTAGTTTTATTTAGAGATTGATTTCAGTTTTAAA AAAAACTGAAACTGCGTTTGGTGGTTTAATTTTTGAAAACATGTAATAATATATTAAATAAATAATATTATTAAATATAT TAAATAAATAATATATTAAATATATTAAATAAATAATATATTAAATATATTAAATAAATAATATTATTAAATATATTATA TAAATAATATTATTAAATATATTAAATAATAATATATTAAATAAATATATTAAATAAACATATATAATACAAAAACGGTT TCAGAAAAGAGGGAAGAAAATGAAAAAGAAAAAAAAAAGTGAAATCCGTTTTTCAGAAAACAGAAAACGAAAATGAGAAA ATGAAAACACCTTTTTTTCGTTTTCTGATTTCCACAAAAAGACAAAAACGTTTTTGGTTTTGTTTTTAAAAAAAAATTGC ACCAAACACGTTTTTAACACCCGTTTTCATTTTTTTGCTTTGAAAACCGTGAAAAATGAAAACGAAAACGCAAACAAACA TGCCCTTTGTTTTTTTTTTTTTTGCGTTTTTTTAGAATGAAAAAATGAAATAGGAGGGAAATAACAGATAAAAAATAGAA GTAAAAATGATTTTTTTATTTAATATAAAATAGAAGAGAATAAAGAATAATTTTTAACCGTTTTTTATTTTTTGTTTTTA TTTTTTTTCTCTCGAGCAGAAAGATAGATATTAATAAATTTTTTTGTATTGAAAATAATTTTTTAATAAAATTACTAAAC GTATTTTCAAAACTAATCTTTGTTTGAGATTTGTTTAGTTGGGGGATTCGTCTCCTGATTCGAATCATGGTTCGTGATTC GCTACAGTATTTTCTCTCACAAAAAACACACATAAATCGAAAATGATTCTAATCTCATGGTTCTAATCCATTAACCAAAC GTCTCCTAAAAATGTTTTCATTTTTATTTTTATATAAAAAATAAAATTATTTTAGAACGAATTTCAAACACACTCTACAT GACTAGCAAAAAAAAAAAAAGGTAAAAATTTACATGAGCGAGGGTATAATAGAAATGGGTAAAGTAGTAGAAGTGACGAA TTATAGCCCCGTTCACTTCACCAATTCGAGTTTAGAATTTGAATTTTGTTATAGTAAAAAGCTCTCAGAAACAGTCACAT TTAACTTTTTTGTTACAGTAAAAAGCTCTCACATAAATACACATCTCAACTCAAATTACAAACTCGAATCAGCGAAGTGA ACGGGCTAAAAAACAAGTAGTAGTAGTGACGTATATGATGATATGATCTTTTATTTTATTTTGTACTCGTGTATATTGTT TTTTTTTTTTTATAATTACTAGAGTGTATATTGTTATTTTTAAATTCTATACATATCTATCTCTGAGTGATGGTAGAACT GACAATACGGATTGTAATATGATAACGGATGTGATATGATCTGTCAATGTTGAAAAAATAAACCATGAGTTGTTTTAAGT CTATATTTGAATGAACAATACTATAAGATATTATAAGGTATTAGTGGTGCTTAAAATTATTGATTAATAGAATGTGGGGT TCTGCAGTGTGGGACTCACAAGTGGGACTCAAATTTTATTAGTGATGGTACTTAGTACCTCCACACTGGTGGTGCCTTTA ATTATATTTCTATTTAAACTCATAATTTTGATTCTATTATAGTACGTTTTTCATTTCACAAAGATTTTAAATTCAAAATT TTATTCTCTCATAAAGTTTCCGTTAATAAATCAGAATCACTGACTTAAAAGCGTGAATCAAAAGGACCTTTACACTATGT TTGGTATGAATGAAAAGTGGAAGGAAAGAAAATGTTGGAGGGATTTTAGGATGGAAATTGGTAAATTAGCTTGTTTGGTA GAAAGGAAATTGGGAAGGAAAAGAAAATTGAATAGAAATTGTGATTGGTGGGTCCCACTAAATTTAATCTCTTCAAAAGT GGGAGGATTTTAGGAAGAAAAATGTGGATAACTACCTAAATTACTAAATTGTCCTCATTTTTTATCTAGCTCCAAAAGTT GACGCTTTTTTTTTTTGCCAGAAAGAGATAAATGGGCTTTCTCTCTCTACTCAGCACACCTTTCACACGGGAAAAACTTC ATTCCATTGCTGAAGATTGAAGGTAGTTCTATTATTCAAGATTGAAGGTACATGGTCTAAACTTCAATTTTAAAATTAGC TTTGTGAATGAATCTCTCACTCCCTTGCTTCTTGTTTCGTTCTCTCTCCTTTTTTTTTTTTTTACAATTTACTCGTCCAA ATTTTTTTTCTTTTGCTTGTCTAATAAATTTTATTTGACAATTTTAAAATTAGCTTTGGGAAGCTCTCTAATGGATTCTA ATGCTATGGGTTTTTGAATTGAATGTGAATAAAGCAAAGTCTCTCCCTGCTTTCTTTTTCCCTAAATTATTGTCATAGTG TATTTATTCTAATTCAGATTTATGGTAGTTGCCTATGTTCAATGGGATATGTTGTATTTTATTTAGATTTTCATGATGTC TGTTTTATAGATTTTTTTTTATTTTCTTGACATTTTTTTTTATTTTTAAGATATGTTGCATTAGTATCCTATATATAATT TTGATTAGAACCATTTCCAAATTTTTCAAGTAGATGAGAAATTCTGAATGGAGTTTCAAGAAAGGTCAAGAGGATAATGT TTTGGAGTATAATCAACTAGACATTCATGAAGAAGTTGTTACAAGACTTTTTAGGAGTTGGGAAAGATGTAGAAGTAGGG TTGGTGTACAAGTTGTTTGCTATGTGATACAGATGGTGTATATAATGCAATTACACTATTGCTCAAATTATGTTGATAGG AGCATTGTCAACATAAGTAGAGAAAGTGATAGTGTGAGAAGGGAACTCATGACTCAACTTAGCGTAAATGAAAAATGTCA GGACGTAATTCGAATGGGGCCTCGAGCATTTGCTAGGTTGTGTGGATTGTTTCGAGACATTGGTCATCTTAAGGATAATA AAAATTCTGTGGTAAAAGGAACAAGTAGCCAAGTTTCTATATATATTAGCGCATAATGCTAAAAATTGAACTATTTCTTT CTTCTTCCGCCGATCTAATGAAACAATAAGTCGACATTTTCATGAGGTACTACGGGCAATAATTAGTTTAGAAGATCAAT TCTTAGTTCAGCCAAATGGAGCAGAGATTCCTCAACAAATAGTTGATAGTCGTAGGTTCTATCCATATTTTGAGGTAAAC AAAAACTTAATCATTTTAAGTTTTATTTCTGATTCTTGTTGAAAATAAATAGTAACTTTAGTTTAATGTTTAGAATTGTG TAGGAGCCATTGATGGGACACATATTCGAGTAAATGTACCTAGGAAAGATGCACCACGATATCGTGGAAGGAAAGATTAT CCAACACAAAATGTTATGGCGGCTTGTGGATTTGATATGAGGTTTACATATGTATTACCAAGGTGGGAAGGAAGTGCATC CAACTCAAGAATTATAAAAAATGCTTTGTCTAGGGAAGATAAACTTATAATTCCTAGAGGTAATAATAAGTTTTATTTAG TTCTTGAAATTATTTATCCACAAAACACTAAGACAATTAATGTTGATTTACTTCATCAAGAAAATATTATCTGGTTGACG CGGGTTACGTGTTGCGTAGTGGACTAATTACACCATATAGAGGAGTGCGGTACCACTTGAAAGAGTACTCTAGACGTGGT CCTGAAAATTGTCAAGAGTTGTTTAATCTTCGTCATGCTTCGCTACACAATGTCATAGAGATAACTTTTGGGGTGCTTAA AAAAAGATTTTCCATAATATATACCGGTGTAGAGCAACACTATCCTATTAAAATAGCCACTGAAATTGTGTTAGCTTGTT GTATTTTGCATAACTATCTAATGGGCGTGGATTCTGATCAACAAATAATTGAAGCGGTTGATCGAGAGCTTTTAGAAAGA GAGCCTGGGATAGAAAGTGTCTACTCTGAACAAAAGGATAATAGAGAAGCTAGAACGGGAGCAACTTTAAGGAACAAAAT AGCACAACATATGTGATGAGACTATGCGCATCACTAGAAAATATATGTTGATAGTAATTTATTACTAGATTGTTCTATTG AGAACATGTTTACTTTTTGTAATGAGAACATATGAATAAGAACATGTTTTGTTATGCAATCTTATGCAGTTATTTAGATG ATCTAATGATAGTTTCTTTACTTTGCCATTTTTTAACATAAGGTGTTGTTTAATAATGTGTTTATGAATGCAATATTATG TTTCTATTTGTTGTGAATGTCGATCAATGGTTGTGTGTGATTTCACTGTCTTTTGCCCCAATTGAATACATCTCTACATG TTGTCGTCTTGGCTCCATGACTCTCGTTTTGATTGTCATTTTAGACACCTGTTGTGCTTGATGATATTTTGGGCCCCATG TTGTGCTGTATGTTTTAGGGGATAAAACAAAAACCATGGTTGATTCAGTGATTTCAAACTGTATTGCTATTTCTTTGTCT GATTTTTTGAGCTCCTTTTTTCTTTTGGTTGAGAATTTAGTTTTGTGCCCTCACTCTGTTTGTATTTGGATATAGTTTTT CTAAAAAATTTGAATTACTGAGTTGTATGGTTAATTGGTTCTTTCGCATTATGTGATATCAAATATGTGTATCTGAGTAA AAGTCGTTTTTTATCTTGGTTATGGAAGTATAGCATAGGAATCAATTAGTTCAATTCTCAATTTTGTTTTGCTTTTTTTT AGCATTGCTTTAGAGACAACAAAAACATAAAAAAGCAGCAATTTAATTATTAAGTGAAGCTCTTACGCTCGGATAACAGC TTCAACTCGTGGAGAATAACTGATATGAATTAGAATGATTTTGTAATTGAGATGTGGTTTTAGTATATAGCATCTAAATG GTAAAAGTTAAGGCCTTTATGGGTGATTTAGTAGATGATGGATACAGAGTTTTTGCTGAAAATATAATGGATATAGATTT GGAACTTGAGGAAGTGGATCTATGCTAGGAATGTGGTTAGCCATAAAACATTGTCCTTTGATGCTTCGCTACGCAATATC AAGAGTTGTACTCTAGACGTGGTCCTAATCACATATGATTTTTGTTGATACTTGACTGCAGATGAATATTAGAAAATATA TATGACCATACAAATTAATACTTTTGTGAAAAATTTCGCTTACTTTACAATAGTGGATGCATAGTATACTAGTCACTTTT TTGTTGTATTTGAACCTTCAACAAGTTGTTGTATTTAACTTGCAGCTAGCTACTCTTTTATTGTATTTAAACGTTAACAA AATTATTGATGCATTAATGCTATATAAGTTAAACTATGTTTTTGTACCTTTATATATGTATGTGTTTGTATATATACATA ATATAGATGGAATATATGTTCAAGTTACATGAATTTTTTGAGTTAATTTGATGTTGAATACTGCATTATTTATACTTTTA TTAGAAAAGAATATTAATAAAAAATATTTAGGTAAAAAAGTAATTACACAAATAATAATTTTTTCATCTCTTTAGTTTCA CTTTCAATACCAAACAAGGGAATGTAGATTCATTTTCTTTCTTCCCTATCATATCAAACAAGTCAAGGGAAAATCAAAAT CTTTTCTATCCTTCTAATTTTCTATGCATTATAGTTTTCCTTTCCTTTCTATTTGCTTTCCATCTTACTAAACAGAGCAT TAATGTCAACCTAAAATTAACCAATTCAAAAACAAGTCGTACTCGTATTAATCTACTTGACACTAAATTAATCAGCTCAA TTATTATATTATTTTTAAAATATTTTTTTCTCATTTTTTGTTATCTATGTTTTAAATTTTTAAGTCTTAATTAGTTGTTG TAGTATGAAATTGATTTAATTTTAAGAAGATATGTATTTTATTTCATGTTTATATAATCTTAGTGCATACATTACATATT CGAAGTAAAAAAAAAAAAAAAAAAAGATCGTTGATGAGTTGCAAGTTGATTCAGGTTAACTGCATTGCGGGTTGATTGTA AATTATAGGTCACAAAGGTTATTCATGTCGGCAGTTTGTATTGCGGGTGAGTCGTGTTAGGGTTGAGATTTTTCAATCTT GTTCATGTCACCGGTTGTGTTAGGAATGTGAACATTTCTACAAATATTGACCTCACCCGACACTAATACAACCTACCATT ATAAATTGTTACCCCTAAGTGATGGCAACAGAGCAAATTTGAGGTTTAGTAGTCATCTCGTCACCCCACATCCGTGATAA ATATAGTCCTTATCCTCGCCCCCACCTTATTTACCTTTTTAAAGTGGCGGAGTTGGACCGGTTTTCCCTGCGCGGCAGGT TCAGGGTGTTTATGGAGTACTTGTTAACCAGCTTAATTAAAAATAAATAACATAAATTTATGATATAAACTCACTATAGC AACAGAGCAAATTTGAGATTAGTAGTCACCTCGTCACCCCATCTCATGATAAATATAGTCCTTATCCTCGCCCCTGCCCT ATTTATCTTTTTAAAGTGACAGAGTTGGACTAATTTTCCCCGCGGCAGGTTCAGGGTGTTCATGGAGTGCCTGTTAATCA GCTTAAAAATAAATAACAGAAATTTATGGTATAAACTCGCTGTGACTAAACTTTAATATAGGCTTTGAAATGGTTTGACT TGCTTTTGAAAACCTAGTTATGATAAGTTAAAGTTTGGTTTCCAAACAAAAAAAACTAGAACCAGCAGCCAAAACGTAAT TATTTGAAAACAAACTACTTGACTTCTAGGAAAATATATTTTTTACCTAAAAACTAGACATTTAAAAGATTTCCAGCAGA TATACATCATGGTCTCAGATACGATATACATACAATTTTTAATGAATTTTACAAGTTAGGGTTCGAAATAGGAAATTTTC AGTTTTTCACCATGGACTTGAGACTAAGGGCTTATTCATTTACACTTTTTGAGTTAGAATAACTTGAGTTCAGATTTTGA TTTGAATTAAGATGTATTTGAGTATAGTTTGAGTTGGGAATCGAATTTGATTTTATGGTCTCGTTCAGTTTGCCGATTTG AGTTTTTTGGATGTGCACATTTGAATTATGGTTTGAATTGTGAATCTATTTGAGTTTGTATTTGGGTAGATCAAAACTTA AATTTGTATTTGGATAGTATTTTAATAAAAACTCAATGATGATGGAAAATTTTAAGAGGGTATATGGATGGAGTTTTATT CGTCTTTTCATTGTGAACGCAAGAGAACCATTACAATCGGAATTAAAATGAAAAAGTTATGATGTTTTTAAGAATAGATA AAATATTGTTAATTAACTTGAGTTTGAGTTTAGGAACTTAAGTTAAAGGGGGAGCTTGAACTCAGATTTTAACCCAAAAC TCAAGTTCAAACTCAAATTTTACAAAAGAACATAAACTTGAATAAAGTTGTAGTTTGAATCCAAACTTTTAAGTTTGGGT GTAAATGAACAAGCCC >DTH_3_2_Mno length=2494;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GAATTAGCTAAATGGTAATTTAGAAAGCTCTCTAATGGATTCTAATGCTATGGGTTTTTGAATTGAATGTGAATAAATTT TATTTATTGCAAAGTCTCTCCCTACTTTCTTTTTCCCTAAATTATTGTCATGATGTATTTATTCTAATTCAGATTTATAG TAGTTGCCTATGTTCAATGGATATACTTTTCATGATGTTTGTTTTTTATATATATTTTTTATTTTCTTAACATTTATTTT ATTTTTAAGATATATTGCATTAGTATCCTATATATAATTTTGATTATAACCATTTCTAAAATTTCTAAGTAGAGGAGAAA TTCTGAATGGAGTTTCAGGGAAGGTCAAGAGGATAATGTTTTGGAGTGTAATCAACTAGACATTCATGAAGAAGCTATTA CAAGACCTTTTAGAAGTTGGGAAAGATGTAGAAGTAGGGTTGGTGTACAAGTTGTTTGCTATGTAATACAGATGGTGTAT ATAATGCAATTACACTATTGCTCGGATTACGTTGATAGGAGCATTGTCAACATAAGTAGAGAAAGTGATAGTGTGAGAAG GGAACTTATGACTCAACTTAGCGTAAATGAAAAATGTCGAGACGTAATTCGAATGGGGCCTCAAGCATTTGCCAGGTTGT GTGGATTGTTTCGAGACACTGGTCGTCTGAAGGATAATAAAAATTCTGTGGTAGAGGAACAAGTAGCCAAGTTTCTATAT ATATTAGCACATAATGCTAAAAACCGAACTATTTCTTTTTTCTTCCGCCAATCTAATGAAACAATAAGTCGACATTTTCA TGAGGTACTACGGGCAATGATTAGTTTAGAAGATCAATTCTTAGTTTAGCCAAATGGAGCAGAGGTTCCTCAACAAATAG TTGATAGTCACAGGTTCTATCCATATTTTGAGGTAAACAAAAACTTAATCGTTTTAAGTTTTATTTTTGATTCTTGTTGA AAATAAATAGTAACTTTAGTTTAATGTTCAGAATTGTGTAGGAGCCATTGATGGGACACATATTCGAGTAAATGTACCTA GGAAAGACGCACCACGATATCGTGGAAGGAAAGATTATCCAACACAAAATGTTATGGCAGCTTGTGGGTTTGATATGAGG TTTACATACGTATTACCAGGGTGGGAAGGAAGTGCATCCGACTCAAGAATTATAAAAAATGCTTTCTCTAGGGAAGATAA ACTTATAATTCCTAGAGGTAACAATAAGTTTTATTTAGTTCTTGAAATTATTTATCCACAAAACACTAAGACAAATGTTG ATTTACTTCATCAGGAAAATATTATCTGGTTGACGCGGGTTACATGTTGCGTAGTGGACTAATTACACCATATAGAGGAG TGCGGTACCACTTGAAAGAGTACTCTAGACGTGCTCCTGAAAATTGTCAAGCATTGTTTAACCTTCGTCATGCTTTGCTA CGCAATGTCATAGAGAGAACTTTTGAGGTGCTTAAAAAAAGATTTCCCATAATATCTACCGGTGCAGAGCAACACTATCC TATTAAAATAGCCACTGAAATTGTGTTAGCTTGTTGTATTTTGCATAACTATCTAATGGGCGTGGATCCTGATCAACAAA TAATTGAAGCGGTTGATCGAGAGCTTTTAGAAAGAGAGCCTGGGATAGAAAGTGTCTACTCTAAACAAAAGGATAATGAA GAAGCTAGAAAAGGAGCAGCTTTAAGGAACAAAATAGCACAACATATGTGGCAAGGCTATGCGCATCACTAGAAAATATA TGTTAATAGTAATTTATTATTAAGCTTTTATACTAGAACATGTTTACTTTTTGTAATGAGAACATATGAACATGTTTTGT TTTTTGTATTAAGAACATGTTTTGTTATGCAATCTTATGGTGTTATCGTCTTGGCTCCAATTGAATATATGTTTCGTTTG AATGATGTTTCGTTTGAATTTACTTTTGTGGAAATTTTTGCTTACTTTATGATAGTGGATGCATAGTATGCTAGTCACTT TTTTGTTGTATTTGAACCTTCAACAAGTTATTGTATTTAAACTGTAGCTAGTTACTCTTCTGTTGTATTTGAACCCACTT AATTGTTGTTATTTTTATTTCTTAAAGGATCATTCTTTGTTGACTACTATCTTGTTTTCATTCCCTTTTTATTCCTTTTT GTTTGTGATTTGGGCGAGTTGTAGAATTTATGGGTGTTGGAGAATGGTTTTTAGCTGCATATTTTATACTTTTTGTGCTT AATGTTGAAATGGCTTGGATGGGATTTCATTTAGGTTGCACAAATTTTGGGAAGCCAGACTTGGCCCCTGCTGCTTGGGT GAGGAGGCTGGTCACACTGTGTGACCAAGCTCCTGCAATCCCATTTGATGCGGTCCAACGCGTGCGGGAGAAGGAGTTTG GCCAAAGTATTTATATTTTTATTAGAAAAGAATATTAATAAAAAATATTTAGGCAAAAAAGTAATTACACCAATAAGAAT TTTTTCACCCCTTT >DTH_3_3_Mno length=623;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GTTTGATGTAAGTCAACATAACATTTTACTTGATTATTCTTTCGTTTATGTTACATAACCTTGTTTGGACTAATCTACTT TTACTTTGCAGAACTGTGTTGGTGCACTTGATGGGACACACGTTCCTTGCGTTCCGCCGCCCGACAATCCAGAGGTATGG AGAAATAGGAAGGGATTTATGTCTCAAAATGTTCTGGGTGTATGTTCGTTTGACATGAAGTTTACATACATGCTTGCTGG ATGGGAGGGATCTGCACATGACGCCCGCGTGCTTGAATCAGCCCTTGATGGCCGACACAAAAAGTTTCCAACTCCTCCTG AAGGTAAACATCGTTTCTACATTGTTAAGTGGTAAAAAGTTGGAATTTAATTATCTTCACGGATGATTTTGTAGGCAAAT TTTATTTGGTAGATTCGGGCTACGCAAACAGAGGTTGTTTCCTAGCACCATACCGTGGTAGTACGTCGGAATTGTATCGA GCGCACATTTGGGGTGTGGAAAGCAAGGTTTCGCATTCTCAAGATTATTAACAACTACCCAATGAAGAAACAGGTAAAAA TACCTATTGCTTGTGCGGTCATACATAACTTCATACGCATGTTTCAGCATGATGATAGATTTA >DTH_3_4_Mno length=2485;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TAGAGTTTGCTCTGAAGCTTGCTGAAGTCTTGAAGGAAATTTCTTATTGCAACGGTAAGATACTTCTAAAACATTTATTT ATCCAAGATCTGATAATTTTGTAACTTAAAGAAAGATGAAAAAAAAATGATGAAGTTGATTAATTAGTTTCATTTTACTT ACTAATTTTCGTTATTTGTGTGTGTTATTTTTATTCCGTCTATGTGCAATTATTTATCTTAGGTATGCTACAACAAGTGT TTGAACATTGTGTTGTGCTACTTATCCTGCTCATGTATTATGTAATTTGCATTATTATCAGTCACTTTTTTTTATTGAAA GTAAATTATGCTAAATAGATGGCTGAAGAGGAAAGTTTGGAAGAGAATTTTATACAAACATATCAACAAAATATTACAAG GTTTATGAGTAGTTGGGAAAGACAAAGACGTATGGTTGCTGTCCAACTTGTTTGTTATGTGGTAGAAGCTATATATATAA TGGAATTATATGATGCTTCCAATTATGTTGATAAAAGCCTAAGAAACATTAGTAGTCATAATGCAAATGTAAGGAACGAA CTCATGGAACAACTTAGTACCAATGAGAAATGTCGAGGTGTAATACGAATGCGTCCATTTGCATTTGCTTCATTGTGTGA TATACTTCGGGAATCCGGTCACCTCAAGGATAATAAAAATTCCATAATAGAGGAGCAAGTGGCTAAGTTTCTATATCTAT TAGCACATAATGTGAAAAATCGCACTATGTCTTTCTTCTTTCGTCGTTCTGGAAAGTCAATAAGCAGACATTTTCATGAG GTGTTACGAGCGATTATTTCCTTAGAAGATCAATTTCTACGACAACGTAATGGAGTTGAGGTGCCACAACAAATATTAAA TAGTAACAGATTCTACCCATACTTTAAGGTAAGGTAACCATTTTAACTATACATTATATGTAGTCTATATGCATGCTTCT TTATATGAAATTAAGGTTATTCTTATTTTAGGATTGTGTAGGAGCAATTGATAGAACACATATTCGTGTGAAAGTGTATG AAGAGGACGCACCACGATATCATGGAAGGAAAGATTATCCCACACAAAATGTCATGGCAGCATGTAACTTTGACATGAAA TTCACTTACGTCTTACCTGGATGGGAAGGAATAACATCAGATTCAAGAGTTATAAAAAATGCTTTAAAGAGGGAAGACAA GCTTATTATTCCTAAAGGTAAAGCTGTTGCGAAATTGATGCTTGTAATATAATCAATTTTAATTGAAACTAAATTGTTAT TTTTCTTTTGGTAGGGAAATATTATTTAGTTGATGCTGGTTACATGTTACGGAGTGGACTTATAACACCGTATAGAGGAG TTCAGTATCATTTTAAAGAATACTCTAGACGTGGTCCAGAGAATCTTGAAGAATTAATTAACCTTCGACATGCGTCATTA CCGAATGTCATAGAGAGATCATTTGGTGTGCTGAAAAAAAAGATTTCCTATCATATATGGAGGAACAGTATCACACTTTT TTGTAGGAATGCTCACAGAAATTGTGCTATCTTACTTTATATTGCACAACTATCTAATGGGTGTAGATCCAGATTAGCAT TTAATTAATCTAGTAGATCAGGAGCTCTTAGAACAAGAACCACAAATAAAGGAGATTTATACAAAAGAAAATGATGGAGA AGATGCTAGAAAAGGAGCAGCTTTAAGAAATGATATAGCAAAAATCATGTGGCAATACTATATTGCATCAAGAGAATAAT TTTGTGTACTTATGCTATGAGTTATATGCAAAGGATAGAGTAACTGGTGATGGTGCAGCAAGTGCAAAGGATAAGGTCAA ACAATGGGAAAAGGAAGGCAATCGGTTTGTGGATCTTGACTCTAATGGTGAGGTAGCATTGAATGGTTTTGAACAAATAT CTCCAAAATATAACTCTTAAGTTGGAACCTCATCGAAGGGTATGAAAAGGAAATTCTCTATGATGGACTCTCTTGATAAG CATCTTGAGACTATGCAATCTAGCATAGGTGGTGTGACTGATGCAATTAAGAAAGGCAATCAGGCAATTAGGGAAAGCAA TGCCATTACTGAAAAAAGCATTGATATTCTTGAAAAAGGAAGGTCACGTGTTTATTCAGAGCCTAAAATTTATGCAGAGT TGATGAATATTGGAGTTCTTGAAAATCTCCAACTTGACGTCTTTTTATTCCTAATTAAAGATGCATCAAAAGTTTGAGCC TTCTTTGCTGTCCCAAGTGAAAGCCGCTACGAGCTATTGTTGAAGATGATGTACCCAAGCAACGAGCTTTAAAATTTGAT GGTTTGTAGCTAAGTAATAGAGTCATTAGATACTAGCATTTTGATATACATATTATAGAAGAATTAACCTTTTATGGGCT TGGACTTTGATGAGATGACATTGAGAAAAAAAATTTGAGGTCCTTAGAATGATCATTGAAGGATAGTAATGATCACTGAA GGATA