>DTH_3N_1_Mno length=135;Class=DNA transposons;Order=MITE;superfamily=MITE; AATTAGTGTCTAATCAATTATATCATGCCACGTCATGTAAAAAATTTAAATTGCTTTTTAACTAATTCTTTTGTACTTAT CATGAGATGATGTGGTATGATTTAATTAGTTAGACACTAATTAAGACACTAAAAA >DTH_3N_2_Mno length=194;Class=DNA transposons;Order=MITE;superfamily=MITE; TAAAGGACTCAAATCTTTTGTCTAATTTTGATGTCTTAATTGGTGTCTAACTAATTATATCATGTCACGTCATGTAAAAA ATTTAAATTACTTTTTAACTAATTTTTTTGTGCTTATTATGAGATGATGTGGTATGATTTAATTAGTTAGACACTAATTA AGACACTAAAAATTAGACAAAAAATCTGAATCCA >DTH_3N_3_Mno length=172;Class=DNA transposons;Order=MITE;superfamily=MITE; TTTGTTGTCTAATTTTTAGTGTCTTAATTGGTGTCTAACCAATTAAATCATACCACATCATTTCATGATAAGCACAAAAG AATTAGTTAAAAAGTAATCTAAATTTTTTACATGACGTGACATGATTTAATTGGTTAGACACTAATTAAGACACTAAAAT TAGACAACAGAT >DTH_3N_4_Mno length=118;Class=DNA transposons;Order=MITE;superfamily=MITE; TTGGTGTCTAACTAATTAAATCATACCACATCATCTCATGATAAGTACAAAAGAATTAGTTAAAAAACAATTTAAATTTT TTACATGACGTGACATGATATGATTGATTAGACACTAA >DTH_3N_5_Mno length=116;Class=DNA transposons;Order=MITE;superfamily=MITE; ATGTCTAACAATTAAATCAACATTATATAAAAAATTTAAATTACTTTTTAACTAATTTTTTTGTGCTTATCATAATATGA TATGATTTGATTAGTTACATACTAATTGAGACACTA