>DTH_29_1_Mno length=3386;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AAACAAGATTAAACCTATGAGACCAAAGAAAGGCAGGCAGCCATTTCACACAATGTTCGAAATATTCAAAACTTCTAAAA AGACTAAGGATTTAGCACATTGGCAGTAGAGTTTAAGTTAATTATGGATAACNTNGTTTCCGCATATATNAGTTCTTTCG ACATTGTATTGTTGTGCAGATGAACTCTTTGTTCTTATTGGATTTAGTACNTTGGCAGTGATGATTTTCTTGGCATATCN GTTTCGTTGTAGCNATATCCTCTTGGTNTNTGGCGTTTATCAGTTGCTACTGCATGTAATTAGGTTTNCTTGGATTGAAT GCCATGTGTTGTCGTTTGTTATTGCATTATGACCTATGCTTTTAAATCCCTGGCCTATTACTATGTGGTTTGGTAGCATA AGTGCCATCCCAGGAGGATAATGCTCCGAAACTGNGATGATACAATTATAACCAAATCTGAGCCAATCAAACGATTATGT ACTTTAATCCTCTTTCTTCTTTGTCGTCGCATATGTCNCTTTGTTCTCGTGGTTGGTGGTCTTGGATTGTATGTATTAGA TGCCGCGAAGGAGTGAGGATGACGTGACCTTCTATTGGTCTGAGAAACAAAAAATTGCGCTTTTGAAGCAACTTGCGGAC TACAATAAAAACAACANGGGCCGTCAACCTGAATCGGCGGATTGGGAACAATGGGCGAAAGATTTGTCCCCACTTTTTTC ATCACCTATTCCTCCAGGGCGCGTTAAANAGGCAAAGGAACGACTGAAGAAAAAATTCAACGCGGAGCTCGCCCTCCGCA CAAACACCGGACTAGGATGGGATCCAATCAAGAATACCCCAACTTGCACTGACGAGTATTGGAATGATTTCTGTGAGGTT AGTATATGGCATACGTACTCCNTAATTTCCTTTGTTATATGCTTTTTTGTTCATGACATTTAACATGATTCAAATTCCCA AAGTGGGAAAGCATTAGAGGGGTCGGGGCCAGGGGGGCTTNCGCCTTAGGGGCNGGGGGGCCTTAGGGGCTGGAGGGGCT TAGGTAGGGGCTGGGGGGCTCGGGCATTAGGGCTTGCGGGGGCCTTAGGGGCTGCGGGCCGGGGCTTGGGCCTTAGGGGC TGGGTCCTTGNCAATGCTGATTTGACTTTCATAATCTACTTCAAGGAAATGCATAAGTTTGCCTTATGGATCTTGTGTTT TGCATTTTATANTTTTTTGTGGCCACTAGAGATTGCTTTATTTGTTTATGTGTTCAACAGACACACAAGTGGGCGAAGCG TGCACGTAAGGATCCCCTNAAGAACTATGAGCTCTACTACGAAGCGTTTGCTAGTAGGCGTGCCCGCGGTGCATTTGAAG AGAGTTTGGAAGAGAATGATGAGGAAGGTGACGTTTCTGAGCCGCTTGTAGGGGAACATGATGTTGATGGCGGCAATTCG CAACATTTGGAAGGTGAGGAAGCATTTGTCAACACAATGAGAGGGGCTTTAAACTCATCAACCCGTCCCCTGAACATGGC CTCNTCATCTCGACATATAGCGAAGCGCAATAGCAGAAGTGGAGCCCGAGGTGTGGATCCNGAGGCAAAATCTATTTTAA AAAGTATTGCAACTACGCTGAATCAGCGNCAGAATAGTCGAGGTACAAGTTCAGGTGCTTCTCAGCGTGTGGAATCCCAG CAANCAACCTTCCAGAAGTGTCAGGCAGTNATTAGTGAGATGTTATTGGACGATGAACAGACTGTGTTGTTCATGGAGTA TATAAATTGGAACCCCAACTGTCAAGAGATGTTCTTGGGCATGAACGATGAATCAAAGGCTGTTTTACGCNTTGAGAACA TTGAAAACCATACCAAATAATCCAGGACCCAACGTGCAGCAACAATATCCATATTATATGAACCAGGGTCCACCGTATGT GGGTTCGTCTGCACATTTTCGCCCACCGGTCCAAAACTTCACACAACAGCAGCCTCCTTTTCCCCCAGTACCCTCTAACC TTAACCCACCACAACCTTCTTTCCAACANCCTACTCCTACTGGCCAACAACCCCTTCCTAACTACCAAAATTTCTCACCA TTCTTCGTGAACCCCAATTCCCACCCCCACCCGGCCCCTTTGGAGGAACCGGAAGTGATGAGATTTAACTTGAGTGTTCG TTTTCCNAGCGTTATTTCTTTTTCCATTTGATTGTGATGTATTGTCTTCGTTTCTTATCTGGAACGATTGTTTCTCATTT CAATTTGACATTGGCTTTAGCTAGCGAGTTCAGTTTGTGAGTGTGTTTGTTGTAACGTTGTAGACTTCGATTTGGAACGT TGATTTTATGTTATGCATTGTTGNTCATTGANGCANTCTGTAATATAACATTGTTCATGCTTATCATNTCGAATATTGNT NTGTATATTGTGGATTGTATTGGCAGACAGGATGTGGAGTGGCGGACCATCAAACGCGGGAAACAATGGTCCACCCGANT ATGACTCTGATGATGACTACATTCTTGGAGCAGCCGCTGCTGCGGTATTCTATACGGCGTACTTGGAACATCCGCTTCCG ACTCCTAGGAATAATAGCCACTACACAGGTACGCAGCGTCTAAGTGATTTGTTAAATGGACACGAGATGGTAATATACAA TAAGATTAGGATGGGCAGCGATTGCTTTAGGCGACTGAGTTGGTTACTCGAACAAAAGAATTTATTGAGGAGTACNAGAA ATATGAGCGTTGATGAGCAATTGATCATTTTCTTGACAATTGTTTGTCAAAGCGAAAGCAATAGAGAGACACAACATCAA TGGCAACACTCGGGGGCTACAATTTCAAAGTACTTCATGGTAGTGTTGAATGCCATATTTCGTCTNCGCCATGATTTTAT TAAGCCACCTGACTTTAACCGCATCGATCCACTTATTGAGGCAAGTGGGAACAAGTATAGACCTTGGTTCGATGTAAGTC CTAAACTTTTATTTTCTTGTTCGTNNTTAACATTATGATTACACGATATTTTGNNTAATAATAACGTTTATTCTGTTTGT CACAGAACTGTGTTGGCGCGCTCGACGGGACGCACGCTCCATGTGTNNCNCCGCTNGAGAATGCCGATGCNGAGGTCTGG AGAAATAGGAAGGGATTCNNCTCACAAAATGTTTTGGGAGTGTGTTCCTTCGACATGAAGTTCACGTACATGCTTGCCGG GTGGGAGGGCTCCGCGCACGACGCNCGAGTTCTTGAATCAGCACTTGAAACGCNAGAAAAGAAATTCCCTGTCCCTCCAC CAGGTACACACAAATCCTAAAATGGGTAATAGTTCGAGTTTGAATCCGTGTGGGTTTAAAAAGTTGNTACAAGTATGCTA AAACAGTTTTTGTTCCCACCATGTAG