>DTH_28_1_Mno length=761;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGCCGTTTGGCATTGCTTTTAGAGGCTGCTTTTAGCTTTTTTTAAGAAGCTACAGCAGGTTAGGGTGTTTGGTAAANCCT GTTTTTGTCCAGCAGCTTCTAAAAACTGTTGTCNAACAACAGAATTTGAGAAGCAGGTCAGGGATTGCTTTTNCACAGCA ACTTCTGCTGTCATTGTCCAAATTTACTAAAATAACCTTAATAATAAAACTTAATTCTCAATCTACCCATTTTATTTCTT CCANATCAAATTAAAAAATATATTTTATTTTAAATATTTATTTGAAAATTAAAAATCTTTAATAAATATNCTATGCTAAA TTTTANTAATATATTTTTATTATAATGTTGCAAGTTTGAAAAATAATTTACCTTCAGTTCTTTACGTTATTTAATTTCTT TATAGATATATAATTTATCTCCTTGAATAAAACTAATTTATTTTTAGAGATATTTTAATTAATAAAATNAAAATTATATT TTTTTAGTATTTTGGTGTATAAATATTATGAATATTGACTATAAAAATAGAAATAAAACTAACTATAAGTATGTGTGTTA AAGTATGTCTATTTTAGTCATTATACATCTTCACAGCAATTTTATACATAGTTTACCAAACACCTAAATTTCTGCTTCTG GTATTCACAACAACTTTGAAAAAAAATTTACCAAACACCTACATGTTTCTGGTCACAACAACTTCTNACTAACAGCACAA CAACAACAAAAATTTTCAACAGCACAACAATGCCAAACTGA