>DTH_27_1_Mno length=884;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGGACAACGTACCATTTACAAGAGTATAGGAATCGACGTGGTAGAGGTTTCAACAGTGAACGTGAATTGTTCAACTACAC ACACTCCTCACTGCGTAATGTGATTGAAAGAACATTTGGTGTGTGGAAGGCCAGGTTTCGTATTTTGAAAACCATTAACC GTTACCCCATACGCAAGCAAGTTAAGATTCCCATTGCATGTGTTGTATTACATAATTTTATCCACATGTACCGTAATGGA GACGCCCTATTAGAGCAGTACTCACAAGATGGCGTTCCAGTTGCGGACATTGATCCTCAGAATGTTGAAGAGGACATCAA CGACAATAACAACCATGAGGGACAACCTTTGAATTACAATGCAGAAGTAGAGATGAATGCATTAAGGGATGCAAGGGCGC ATACAATGTGGGTAGTGTACCGTAACCGTCGAACGCGATAAAAATTGTCCAATTTAAGACTTTGATGTGCTACGAGATGA TATTACATTGGGACTGTATACTTATGTTATAAATTATGTTTTCTTGTTGTCCTTTTCTCTCCATTAATATAGAAAATGAT GTTGTATTTTTTATTTTTATGGTTTTTTAAGGAAGAAAAAGTCTCACGTTATTTTTAAACTTATAGCTACTTTTAATTTA TATCTAGTTTCAATTGCATAAAATTAAATAAATTCAAATAAGGGAAAAAAAAATTTTCTCTCCCCACTATTCACAACTCA AATCTTTATTATACACTCAAACACAAACTCAAAAAGATTCTCATCTCAAACTATAACTCAAATGTACACAACCAAACACA AACTCAAATTATAACTTCATCTCAAATTATAACTCAAATTCAACTCAAGAATTACACTCAAGTCAAACTCCAAAAGAACA AGCC