>DTH_26_1_Mno length=2534;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; CTACCAAAATTTCTCACAATTCTTGATTAACCCCCAATACCCACCCCCACCCGGCCCTTTTGGAGGAACCGGAAGTGATG AGATTTAACTTGAGTTATTTTCTTCCTAGCGTTATTTCTTTTTCCATTTGATTGTGATGAATTGTCTTTGTTTGTTATTT GGAACGATTGTTTGTCATTTCAATTTTAGGGGCTGACTTTAGCTAGCGAGTTTAGTTTGTGAGTGTGTTTGTTGTAACGT TATAGACTTTGATTTGGAACGTTGATTTTATGTTATGCATTGTTGTTCATGAAGGCATTCAGTAATGTAACATTGTTCAT GCTTATCATTTCAAATATTGTTTTGTATCTTGTGGATTGTATTGGCAGATAGGATGTGGAGTGGCGGACCATCAAACGCG AGAAACAATGGTCCACCGGATGATGACTCTGATGATGACTACATTCTTGGAGCAGTCGCTGTTGCGGTATTCTATACAGC ATACTTGGAACCTCCACTTCCGACTCCTAGGAATAATAGCCACCACACATGTATGATGCGTCTAAGTGATTTGTTAAATG GACACGAGATGGTAATATACAATAAGATTAGGATGGGCAGCGATTGCTTTAGGCGATTGAGCTGGTTACTCGAACAAAAG AACTTATTGAGGAGTACACAAAATATGAGCGTTGATGAGCAATTGATCATTTTCTTGACAATTATTTGTCAAAGCGAAAG TAATAGAGAGACACAACATCAATGGCAACACTCGGGGGCTACAATTTCAAAGTACTTCATGGTAGTGTTGAATGCCATAT TTCGTCTTCGCCATGATTTTATTAAGCCACCTGACTTTAATCGCATCGATCCACATATTGAGGCAAGTGGGAACAAGTAC AGACCTTGGTTCGATGTAAGGCTTACCTCTCCTTTTTTTTTTGTTCGTATTAAGCATTATGATTACAGAATATAATGGGA TTAAGAATAACGTTTATTCTAATTGTCACAGAACTGTGTTGGCGCGCTCGACGGGACGCACGTTCCATGTGTACCGCCGC CAGAAAATGCAGAGGTCTGGAGAAATAGGAAGGGATTCAACTCATAAAATGTTTTGGGAGTGTGTTCTTTTGACATGAAG TTCATGTATATGTCTGCCGGGTGGGAGGGTTCCGCGAACGACGCTCGAGTTCTTGAATCAGCACTTGAAACGCCAGAAAA GAAGTTCCATGTCCCTCCACCAGGTACACACAAATCCTAAACTGGGTAATAGTTGGAGTTTGAATCTGTGTGGGTTTAAA AAGTTCGGACAAGTATGCTAAAACAGTTTCTCTTCCCACCACGTAGGAAAATTTATTTAGTAGACTCCGGTTACGCAAAC ACAGGTTGTTTCCTAGCTCCTTATCGCGGTTCTACGTACCACTTGCAAGAATATAGGGCACGTCGCGGTCGACCTCGAAC TGAGCGGGAGTTATTTAACTACACTCATTCATCGCTAAGAAATTGTATCGAGCGGACGTTCAGGGTATGGAAAGCGAGGT TCCGCATTCTAAAGATAATCAACAACTACCCGATGAAAAAATGAGCGAGAATACCTATTGCGTGCGCTGTGATACATAAC TTCATACACATGTATCAACATGATGATAGCTTCATAAATCAATACTTACAAGATGGGGTACCCGTAAGTGAATTGACCCC CTGAACGTGGATGATGATGTCAATCAAAATCATAACCCAGATCGGAGTACGGAAGGACCAAGAAACACCGCGAGTCGAAG GGAGATGGGTCTTATGAGGGATGAAATAGTGAGAACAATATGGCAGGCCAATGGTGGAAATAACAATCGCTAAATAAACA CGTATCAGTTAACATGTATGAAATATTTGTTTTGTAACAGGTAAATCGAGCCATTTGAGGCAATGTCTTTTTTTGTATTT TTTTTCCTATTTTCGGAATTTTTTTTTGGTTGTGACAGGTAATTTTCTCCTTCATTAATTAGTTACATGTCTTAACATAT GAATATGACATTTTAAAAAAATTAGAAACGTGGAATGTTCTTCAGTTTGAATAACGGAAGTTCTTTTTTTCCTTCATTTT ATCATATAAATGGAAGAGAATTGAGATGGTAGTTGGAATAAGAAATCTGTGAAATGAACACATCACAACTCGAATTGTGG GTCAAACTTGTAGCTCAAATGGACTCCTAAACACTAACTCCAATTCCAATTACAATTCCAATCTAGATTCTAACTCCAAT TATAGCTTTAACTCAAATTGTAAAACTTGGATCGGTGAAGTGAACACACCCTGTGAGTTTTTTTTAGTAAAATCTACGTT GCGATATGTGATTAGTTCTTTCTTTTAGTTTGGCACGTGTGAGTTTCTTTTTTGTGAAAAGGGGCTCATGTGGATCACGT TACAGAGGATCAGACACTGATGGAATATGGCTGACAGTTATACCACGTGTCGCGTTCTGATTAGCTGATAGAGAATCATG GTGGGACTCACTTGACGGATGAGGGAGGTTTGCCTGATTTCTACGCTCATTGGT