>DTH_25_1_Mno length=2535;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGTGTTGATCAAAGGATCTACTTTTTCGCTTTGGATTTGTTTGAAAATCCGAACGCCAGAGAAACTTTCATATCCCTTAA AAGCGAGAGGCGGTTGCCATGGTTGCAGGGAAAGTCTGGCGCTTCTTCTAGTTGAATTAGGCTGAGAGTTACCTTCTCTA ATATATATACAGATGTTTCTTTTTTTTTTTTTAATGTCCCATGGCTTGTACAATTGAGCAGACTTGAAAAGTTTAATTTT TGTATCTACTATGACTTTATGGCCATGCCTTTTCCTTGATAACCTAGATGATAGTTTGCGGATGTAGCCTTCATCAATTG ATTTAGAATGTCCTGTGGTTGAAAGCCATAACTTGTTGAAATGCTTTCAAAAGTTCAATTGTTATATTTTCTTGTACAAT ATTTAATGCCTTTTATGCAGATATGTGAGCTGGCATGGATGATTTTGACCTAGAACTGGATGAGATGGAATTGATTGCAG TTGCTGCCGGCTACAGCTACTATAACAATGTTACGAGCAAACCTTGTCGTAGCTTGTCACCCAAACAAGGATGTGGCTTT ATGACTGAAGTGCTGAATGGTCATGACCACATTTGTCGGGAGATGTTTCGGATGGACAAACATGTATTTCACAAGCTGTG CGACATTCTTCGACAGAGAGCCATGTTGCGGGATACTGCTGGTGTTATGATAGAGGAGCAGCTGGGAATTTTCCTCAACA TTATCGGTCATAATGAGCGCAACAGAGTAATCCAAGAGAGATTCCAACACTCAGGTGAAACCATTAGCCGATATTTTAAT AACGTACTGAAGGCAATCAAGTCATTGTCACGTGAATTCTTACAGCCACCACCTCTCACCACCCCCGCCGAAATCCTCTC AAATCAAAGATTCTATCCGTATTTCCAGGTTCATGTTCAAATGCATATATTTTTCTTGTCTGTGTTGTTATAGGCAAGTC ATCTTTACCTTGTTTATTACTTTTGTTTCAGGACTGCATTGGAGTCATTGATGGAATGCACATCCCTGCTCATGTCCCAG CCAAAGATCAATCCCGTTTCCGTAACCGAAGAGGTGTTCTTTCACAAAATGTGTTGGCAGCTTGCACGTTTGACCTAAAA TTTATATTCATTTATCCTGGTTGGGAAGGCTCTGCTGCAGATTCCCGTGTATTAAGGGCAGTTCTCAATGATCCGGATCA AAATTTCCCCCAGATTCCAGAAGGTTTGAGCAGTGCGACTATAAATATACTAGAAATTTTTTACTTGTGAATCTTATCCA GTGATTAAAACAATGTTGCTTATTTCCGATAATTACAACGTGTTAGGCAAATATTACCTTGTGGACTCGCGATACTCGAA TATGGAAGGGTTTATTGCTCCGTATCAGGGAGTCCGGCATCACCTCCATGAATTTAGAGGTGCTAATCAGTTGCCCAGAA ATGCAAAGGAACTATTCAATCACAGGCATTCTTCTCTAAGGAATGCCATTCAGAGGTCTTTTCAGGTTTTGAAGACTCGA TTTCCCATACTCAAAGTCGCTCCTCAGTATGCATTTCACATTCAAAGGGACATAGTCATTGCTGCGTGTGTTATGCATAA TTTCATCCGCCGCGAGGAAGAGAAGGATTGGCTGTTCTCTAGTGTGGAAGGGGTGAAAGTGGATGAATTGCCTGAGCTAG ATGAACAACCTGAAATCCAGTTGGTTTCTTCAATACAAGAACAAGTTGCCTTTTCGATGAGAGACTCGATTGCCGCTGCA ATGTGGGATAACTTCATTAATAAATGGGATGACTGGTGACTGTTTGTGATGGTAAGCTTTCTTGAGAGATGACCCTCGTG ACGTGGCGTACAACTGCTAACTTGTTACTTTGCTAAACCTAGGTGGAAATTTTGCTTCGTTGGCAGGACAATTGTTCTTC CGTGCACTTGTTTTGTTAACTGTAAGTTTCTGTTGCTTTTGGCTCGTCCTTCTTCTCTTTATATGTTTTGCGTACAATCA TGCTATGCTTTTTGTAACGCGTTGCTGCATGTAAATAATATCATGTGATTGGGGGAGAAGTCTCAAATCTCAATATGATT GATCGTTTGTTTTTTGTTGTGCCAATTTTGTTGGTATTTAGTTCTGGAATTATCAGGAACGATAATGGGTCCTACATGTA AATGTAATCCTAGCCTCTGTGTTCTGTTCTGGTCTGGTCTTCCCATCCGAGGCTGAGGTGCAAAATTGCAATTAATGGAT TTTGTTGTAGGAAGAAAGAAAGAACCAGACCAGACCCGGTTCACTAAATCGCTGGATCAATTGTAGAGTCGTGTTAAAAA AGAGTACGCCAGTAAGTAGAGTAACTAATAAAACAAAGAAACAAGTGAGTCCGTGGCATTGCTCGACATCGTGGGGGATT GGTGGTAAAGTTGTCAAATGTCAAAAGAGACGCCATTAATTGGAGCGTTATAAAGATTTACAAATGCAATGCTTTGCACA GAGCAAATGCAGGAAGCGCATGGCTTTGCCAGTTGCCTGCCTGGTCATGAAACAT