>DTH_24_1_Mno length=4342;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AAGAGAAATCATGCAAGTAACTTGTTGCTAGTAAATTGATAAATTTTTCTAGTTTGAAGTTGCAACTAAGCAAGGCAGTG TTGTTATCAGAAAATTATAGGCCCTATTTGTTACGCCGTTCGAATTTAGAATTTGAGTTGAAAAGTGAATTTATGTGAGA AAACAATGTATCAGAAAAAGTTGAATATTTGAACTTTTGTGAGAGAAAACACTTTAGCAAAAAGTTTGAGTTTTGATTCA AATGGTGAAATGAACAAAGCACTAATGATTAGATGTCATTCCTCTGGTGATTTGCGTTCTATATTGTTCTGCCTCATGTA TGACTAGATTTTATTATCTTGGAGTTTAATTTATTAAGTTGGTAAGAGTCCTCATGAGACTCAATTAAGATTGAAATCCT TAACTGTCATCTTAACTTTTGCTGATTTGTGCTGTTTACGTTGCTGAATGTAGAGATTGGATTTTGTAATGGAGAGCTCT GATGATGAAAAAGATGCGGTTTACAGGAATTATATCCCTAAAGAACTAAGTCGTGGTTTAGCATCTTCTGGTGCAAAATT TGTAGACGAAGTGCTCAATGGTCAAAATGAACGTTGTCTTGAAAATTTTCGCATGGATAAACGTGCATTTTATAAGTTGT GTGATATTTTGCAAGCCAAAGGCTTACTACGCCACACAAATCGGATCAAGATTGAAGAGCAATTAGCCATATTCATGTTC ATAGTTGGTCACAATCTGCGCACTCGAGCTGTACAAGAGTTATTCCGCTATTCTGGGGAAACCATCAGTCGCCATTTTAA CAATGTTCTAAATGCTATAATGGCAATTTCATTAGATTTCTTTCAGCCCCCAAGCTCTGATGTTCCTTCAGAAGTTTTTG AAGATCCCAGATTCTATCCATATTTTAAGGTAACCTGACAGTTATTAAGGCTGATCAGAATCTGTTGTTTACCAATGTCT TTCTAATATTTATTAATCTTTCTTTTGATAGGACTGTGTTGGAGCGGTTGATGGAATGCACATTCCTGTAATGGTTGGTG TTGATGAGCAAGGACCTTTCCGCAACAAAAATGGCTTACTTTCACAAACTGTTCTGGTCGCTTGCTCCTTTGATCTCAAG TTCCATTACGTCCTTGCTGGCTGGGAAGGTTCTGCATCAGATTTTCAAGTTCTGAACTCGGCACTCACAAGGCGAAACAA ACTGTCCGTTCCTGAAGGTATGTTACTTCCTTTTCAGCTGAGACTATTTAAGATAGGATGAAAATATCGGTATCCGTAGA AATATCAGTACTTCATTTTTATGGAAATTTCATAAAAAATATCAATAAAATTTACGGAAATTTATAGTAGACAATATTTC TATTAAAAGATACATAAATAAATAAGTTTTACATAAAAAACTTCATACATTTTACATTTCTTAATATCAAAAGGAAGTTC TATGAGGCTCAAATGTGGTTGGGATCCAATGCAAAAAATAAAAATAAAAATGCTTTGCGCTTCAAAACCTCAACGGAGTT TTTACTACAGAGGTAATTATATAAGGTTAGCATGTACACCAATTTGAAGCATTTAAATTTATCATGTGGGTGTATGTACT GCATGCATGCTAATATTAGTAATCGCCCGTTGTTGGTGCAATTTTTGCTAAGTGTATCATTTGAATTTAATCTTAGAAAT TACCAAAACAAAGATAGCTACCTTTACTATTTGAAGGATGAAATTAACCAAACTAGAATTATTCTCAATTAATATATATA TACATATATAGAAAGCATAACTATGTCGGAGACTCGGAATTGTGTAGCAAATAACCATATGCCAAAAGAGTAGGAGGGGA GTTATAGAAAGAGCAAGAATGACAATTCGTTTATCAAGAAGAATGGTGTAAATATTCATCTGCGTAGAACATGATTTTAC AAGGGAAAAAAAAGAGAAGAGTTTGTTGTGTATGCGGTGAAAGTTATTGAGATGGGATAGCATTAAGTCCTGCAAAGTTC TGTAGCAACATGTTCAATACTTGCTTTTTCTAGAGACAAAAATGAAAAGCTGAAAGATGCTTCTGAGTTCTGCATAGTTT GGTTACTAGATGACAGACCAAATTATGCAAAAAACTGATATGATAAAGCAAATTTAAATAAAAAAAACAAAAAAAAAAAG AAAACAAACAAACAAGACTTTTAGAATTCCCGTTTCCACCCCGAAATTTCCCAAAATTCTAGCCTAATTACACTATTTGT AAAATGATATCGATATTTAGACCGTTATTTACTGAAATTTTCGGAACTTTCATGATATTTTGCGGAAATCGATATTTTGG TGGAGAAAAAATCGGCACCCTCAAAAATCTGAAATTTCCACTGAAATTTCAGATATTTCAGCCATATTTTCGACTATGTC TAAGACGAGCTACTTCTGCTGGGTTATTGACACATTGCCTTTCATTTCGACAAGTGGAGTTGATATAGCAAACCTTTATA AAATAATATTCTTGGGACTAAGAAACAATATATTTTAGTGAGGTTATTTATTTATCGAATAGTATATTAATTTATCGGTA AATGAGTATTTATTAATTTAAGAAGGGTTTTATATTTCAATAACTTGTGCCATCTCAGTACATGTATAATTCTTTTGATC AAGATTCATGTATGAGTTATAAATAAAAGAAAATAATGGATGTAGTCAAAATTATTATATTTACATATAGAACTTTAAAA GTTATCATGAATATAATAAATGTTATATTCATTGTTATATACATATACATATAAACTCAAAAATTAATGTAAATTGATGT GCGTATTTTTCAAATTTAATATTTAGAAAGGAAAAAAAAACTCTTAATATAATGAATTTTATATGTTATTTGCTATTATT TTTTTATATTTTATTAATTATTAATTTATATTTTCATCGGGCCTTTTAGGATTAAAAAATATATATATATATTATTGTCT TATGCGTTTAGTGAGATTATTAATTTAGTACACTGATCTAAGTCGGGACTAAAAGATTTTATTATTTAATCAAGATTATT AATTTATCATACATTCATTTATCAAGATTTTATTGTATTATACTTCCAAGCTCCTAAAAGATGGTACTTGAACTCTTCAA CCAAAATCAAACAATGCAGGTAAATACTATCTTTTGGACAAGAAGTATGTGAATTTGCCAGGCTTCATTGCTCCATACCC TGGTGTTCCTTACCACTTGAAGGAGTTTCCTGATGGTTACCCTCCTCAAAATGCCAAGGAGCTATTCAATCAGCGACATT CATTGTTAAGGAATGCTACTGATCGTATCTTTGGCACTTTGAAAGCACGCTTCCCTATATTGATGACAGCTCCTCCGTAC CCGTTACAAACGCAAGTGAAGTTGGTTGTGGCAGCATGTGCCATACACAACTACATCCGGAGTGAGAAACCAGATGACTG GCTCTTTAAAATGTATGAACAGGATAGCCTACTACAAGCGGAAGAATCACCACCATCGTCAGAGATGGATCAACAAATGA TGCATGTAGACAATGCTGCTTTGGACGTTCCTTTCGGCGATGAACAACTAGAATTCTCTTTGCAGTTGCGGGACTCTATT GCATCAGAAATGTGGAATGACTATCTTAATGATATATCTTCTCTGTAGATCCATCCTTGTTTCTGGTCACAGTTTTCGGT GGGGTACAGAAAGTTTTGGGGATTATGGAAGTAGATAAACACTTTTTTGTCATCAACCAAACAGCCAAACACTCACACAC ACACACACACACACAAGCAGCCAACACCAGATTTTACGCAACAAAAGAGTTTTTATTGAAATTTACTTAAACACTAGCTC ATACAAACCAAAACCAGCTAGAGAGATTAAAGAAAACGAAATGGATAGACTGCAGTCTTTGAGGACTTCAGAGAATTCCT AAACTCAGTGGTATTTGAGGGACCACTAAATCTCCTAAAGTTTCCCGAAATCCTCTCAAATCTCGGCCTAATCCCACACT CCCCTCTACTCCCCTTTTAAACCCAAAAGCAAACACTACTCAGTGTCGTGTCGTCCTCCTTAGGTTCTTCTCCCTCTCCG CCAACAAAATTTGAAGTTGCTTGTTCCTGCACCTATGCCTCGGGCCATACTTTTAATCACATTTATAGCAAAGACCCTTT ATGCAGCGTTGTTGCATTTCTTCTTCAGAAATCCGACCTGATGGACTAGAAACCGCCGGTGTAGGTGACTTTCCCCTCAT TTCTTTGCCTTCTCGTGGGGTATTGGACTGAAGGAAGCTTTCTGGAACGTAATGTTGAGTGGTCGGCCACTCACTAAAAG AATACGAGCGCACCAAGCCACC