>DTH_23_1_Mno length=2366;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; CATGTGGGACAATCATCATGTGTGTACCGTCTATTGCACCAATACAATCCTATTAAAATACATAAGGTGAGTTACGATTA ATTTAAAATTATTTATCATATTAGTAGTATATGAGCAGAGTCAAATTGTACCTTAAACCATGGCCAGTACTTAGGTTGTA TTGAATCTCTGGGGGGACAATAGGGGCTGATAATCAGCCCCCATTGGGATTGATGGGGGCTGATTCAGCCCCAATGGGAG GCTCCTAAGGAAAAAATATAGAAAAAAATTAAGCAACTCAGATAATCAAAAAATTAGACAAAATACTAACCAAATCAAAC GGAAATCAATCAATTTCGTTGAGTATATCAAGTCAAAATCATTATAAAAAAAACCCATAAAAAAAACAACTAAATCAGCT AAAAAAATTTCAAAATCAGCTAAAAAAAACTCAACCAACTCAGGCGGGAAGGAAACCAAATCAGAAAACGAATAACTCGG TGAGAAGAGCCATACCTTGGTGAGAAGTGACCGAGACGAGAACGGGAAAATCGGAGGAGCCCTAACGGCGCAAGTCAGGC GAGAAGGAAACCGGAGAAAACGAATCCGGCGAGAAGAACGGAGGAGCTCGGCCGGCAAAAAGGCTGAAGAATGGCTGAAG CAGAAAAAAAAACTCAGACAGGGGAGGCTGAAGAGAAAACGGGAGAGAAAAGGAAAAGAAAACGAAAATGGAGAAAACAG ATTTTTTTCGTTTTCTGATTTCCACAGAACAACAAAAACGTTTTTGTTTTTGTTTTTTAAAAAAATTTGCACCAAACGCG TTTTTAACACCCGTTTTCAATTTTTTGCTTCGAAAAACGTGAAAAATAGAAATGGAAACAGAAACAAACAGGCCCAACAC AACCCTAAGTACTGGCCATGGTTTAAGGTACAATCTGACTCTACTCATATACTACTAATATGACAAATAATTTTAAATTA ATCGTAACTCACGCCTTATGTATTTTAATAGGATTGTATTGGTGCAATAGACGGTACACACATGATGGTTGTCCCACCTG TACATCAACAGACAGTCTACAGAGGAAGAAGACATTTGTGCACTCAAAATGTAATGGCGGTGTGTAGTTTTGATATACTA TTCACTTATGTCAATACCGGATGGGAAGGATCAGCTGCTGATTCCAGAGTGTTAACTGAGACTATGAGAGATCCAGATGA CCCATGGCACCATTTCATGGTCAGATGTACCATATTCAACAGTTTAAAAATTGTGGTCAACCAACGAGACCACAAGAGTT ATTCAATTATTATCACTCTTCACTGCGTAATTGCATAGAGAGAGAGGTGCTTTGGGGTCTTGAAAGCAAGATTTAAAATT CTTAGGCATATGACCAATTATTGGATGTCAAGACAAAATGTTATACCAATAGCTTGTTGTGTGATCCACAATTTAATTAA GATGCACGCGCGAGATAATTCTTTTTTTAGATAATATGAGGTCGATTTGCCCGTAGAAGATATTGAGAGAGAACAAGAAG GGCAACAGGAACAACAACATGATATGGATGCACAAGAAGCAGAAACATCTGAAATTGGTGGTCGGCAACAACGTAATTAC ATGGTTAATTTTAGGGATCATCTAGCTAATCAAATGTGAGATTCGTATAGGCGACAATAATTTAAGCTAATATTGTAATT TTCATATTTTATTAATTATTAGTGTTTTTATTTGTGATTCAATTATTATTTATTTAATATATTAAATACTATTACATGTT TTCAAAAATGAAATCACCAAACGCAGTTTCAGTTTTTTTTAAAGCTGAAATCAATCTCTAAATAAAACTATCAAATGTAT TTTTAGAAATAATTCAAAAATGAAAATGAAAACATTTCCATTTTCGTACAGAAAACAAAAACGTTTTGGAACCAATTCCA AACGCACCCTTTGGTTTTCAACGTCATGGAGTCGAGGTACATGAGTAGAGCTTTGTTTGCAATTTTTGTGCAACTCAATC TGGTTATTTTATATCCTTAACCTACACATTTATTCATTTGCCGATTGTGTTTTCCTCTCCATTTTAGAAGCTATTCAAAC GATCTTATTTTAGGCTAGCCTAATCGCACTTTATTTTGATCCAAAACGAAAAAGAAAAGAAAAGAAAATTTTTAGCATCA CCGCCTTGTCCATTTCCGTTTGTGAGTTCACATCTTTTCACAACGGATGGTTATGGCATTCACAAAAACATTCATCTTTT TTGCATTTTTGGCCTTTTTTTTTGTATGATGGTTGACCTGCATCTAACATAATGGACTAATAAGTGAGAGAAGGCAAACA TTGAGATGATTATCAGTTTAAGTTAAACTGGTAATCTAGGACGGTG