>DTH_22_1_Mno length=5541;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGGGTTGTTTGGTTTACCCGGTTTACTCGAGAAAGCCCACTCGAGTTATGATTCCAAGCCCAAGTTCATGTTCGGAGAAG AAAAACTCGAAATGGAACTCAAAAATTTTTTCGAGTTATTACCCGGTTTTTGAGTTCACCTTCCCCCTGCCACTTGAGTT ATTTTTCTGCACATCTACAGTGCAGATTCCTGCACTTCCCGTTGCAAGCTTTGTTCTTTCTCAGCTTTTCTACACTGCAA TCATGTGGTTCTCCTGTATCCTTGATTCGAAACCGGGTTTAGTCCTCCAACCTTCATCGATTTCTGAAGCCCTCAATCCG TTGCCCGATTTTCCCCCAATCTCCGGATTTCGAATCCGCCGCAGACACCATCGACCCCCCTTCCGCATGTACCGTCACCC CCTTCCTCTACCATTGTCGTCTACTGTTACCCCTTCAAAACGGGGAGATTTGTTGGGACAACGTCGGTGCGGCGACCTAG GTGGGTAAACCTCCTCCTTCGACGTAGAGGAAACGATGCACGCCGTAAAACTGTCCAGCCGAGACGTCAATCCTTGGTCC TCTACCTCTGTCGTCGCCGGTACCTCGGACTTGCTATCCCTTCCTCGCATTTGGGGAATCTCCAAGGGAACCACATCTCC TCCTCCATAGGCTCGAATTCGGTAAGTTTTTTCCAAAACCTTGTGTTCAGTTTATGGAAAATACTTGTGGTGGTTTCTAG ACCCAAATTCGAGCACTAGTATTGGTGAATTCACATGTTCTTCTATTGGCAAAAAAAAAAAAAAACATTTGTAGTTAAAT TTTTTGGTGATTTCAGCCTCTAGATTTCATCGGATCACTTGTATTTTGGAACCCTTTTTTGTTAGTTTTTGAAAAAAAAA CCAACATGTTCTTCTAGATGGCATCTCCGTGAACCTACGTTGGCATTTCTGGTGATTTTTTCATATGCTTTCAGCCTCTA TACTTCATCGAGCACTAGTATGTTGGACCCCTGTTTTGTAGTTTCTGGAAGAAAAACTTTAACTGTTTCCAGTGATTTCT CTTCTAGATTGCATTGAGATATCAGTTCACCCGCTGCCATTTTTTTGGCTATGTTCGTATTGTGTAAAAACCAGTGGCTG TTCTAGTGTTTTTTTGGTGTTTTCAGCCTTTATACTCTGTCGGGGCACTAGTCTGTTGCAACCCCTTTGAGATTGTGGAA TATGTCATTTGCATTTTGATGTGCCCTGTTGATCTCTAACAGTCCTAAATGTTTGCCGGTCACCAATTTACCCATCTTCA CCCTACCGTAAGCTAGTTTCTGGAAAAAAAATAGAAACTTGTTTCTAGTGATCTCTCTTCTATATTGCATCCAGAGAACA GTATCTAGAGGGCCTTTTTTGCCTATGTTGGTAATGTTGGAAAAACAGTGGCTTGTGCTGGTTATTTTTTTGGTGCTTTC AGCCTCTATACTTCATCGGGGCACTAGTTGTTGGAACCTCTTTTTGTTCAGTTTTTGGAAAAAAAACCAGAACCTGTTTC CGGTGATTTCAGCGTCTAGACTTCATCAAACGCTGTGAATGCTTATGTCCACACACACCTGCTAGGTTAGCTACATTACG TACCTTGTTCATCTGTTAAGAATGTTCTCTATGTGCATCGTTCTATACTTACATTATTTGGCATCATTTTTGAATATTCT TTTCATATGTACATTTGTAAATCCTGCTGTGCAGTTTCTGGAAAAGAAAACAGAAACTGTTTCTGGTTTTTTCAGTTTCT AGATTGCAATTCTCCGTGGCTATGATGATATAATTGTATTTAATGGCCTAGTCCCGTATGTCGAGTGATATTCTGTGGCT GGGTTAGTGGTTGGTTGCCGGTTTATCCCATTACTCTTCGTTGGTATGGTTGCTTTAATTCACTTTCAATGCCTTGCTTG ATCAATATGGAGACATTAGCTAAACCTTAGGCAGCATATTGGTTGCCGGTTTATGCATAACATCATGGCATAAAGTGTAT GAGAAACCTACCAGTAAGAGTAATTGAACATAAACCTTGGTAGCCTAACTGTCCTAGCCTTGGATAATGCTCCATAATAG GACGATGACTGGCCTTTACACAAATCTGAGCCTCCTTCCAACATCCGAGCTCATTAAATGAATTTTGTATGCTATGTACA TACGTATTGCTGCCATTATGGTATTGTCAATACATAGATGGCGAGAAGGAGAGATAGAGATGTAAATTGGAGCCCGGAAG CCGAGGAACAACTGCTTAAACGGCTAGGTGAGTTCAATTTATTAAACTCTGTAGGTACCACCCCCACCGAGATAAATACA CACAATGGGCGGCGGAGCTAAGTGAGCATTTTACCGTTCCCCTAACTTGGGACAAAGTCAAACAAAAAGCCAGTAGACTG AAGAAAACGTTTGATGCTGAGTTTCTACTTCGCACTGCCACCGGACTTGGATGGGATCCGATTCAAAAGAAACCCACTTG CACTGACGAGTATTGGCAACAATTTATCAGTGTAAGTTTCTAATAGTATATGTCATTNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAGTGATGATAATTTTTTCATGCAAGTTGTCGCTCCGGCGA CTACGCTATGTGTTGGATTTATATATAGAGAACCTTCTCGCCGAAGGCACACTTCTGGTTGGGGAGGCGCACTTAGGGTG CAGTATTATTTGGAACGTAGTCCAACAGTGATGTATGACAAAGTCCGTATGAGTAGTGATGCGTTCTTGCGACTAAGTTT TATCCTTGAGGAAAGGGGCTTACTGCAACCAACTGTCCACCTAAATGTTGATGAGCAATTATTTATATTCCTAACTATAT TATGTCAGAACCAAACTAACAGGGAGGCGCAGGACACTTGGCAACGATCTGGATCGACGGTGTCTGAGTACTTCACCAAA GTTCTTGTGGCGGTATGCAAACTGAAGCAGGACTTCATTTTACATCCAGATTTCCAAACCGTTGACCCGCACATCATTGC AAGTGGAAACAAATACTCGCCGTGGTTCGATGTATGTTCGGTAATGTATATTATTTACTGGTTTATAATAATTATTACGA CTTCAATATAACCAACATAACATTTGTAAACTCTGAAGGATTGTGTTGGAGCTCTTGATGGTACTCACATCCCATGTGTT CCCCCTCATGAAACTGCTGAACTTTACAGAAATAGGAAGGGGTTTTTCTCACTTAATGTGCTTGCCGTGTGCACTTTTGA TATGAAATTTACGTACATGTTATCTGGATGGGAGGGTTCCGCACACGATGCGCGAGTATTAGCTGCTGCTTTAGAATCCG CACGCAAAAGATTCCCGTACGCTAACAACGGATGCTTCCTGGCACCATATCGGGGGACAACGTACCACTTGCAAGAGTAT AGGGCTCGCCGTGAAAGAGGATTCCACAGTGAACGTGAGCTTTTCAACTCCACCCAGTCTTCGTTGCGTAATGTCATTGA AAGAACATTTGGTGTGTGGAAGGCTAGATTTCGTATTTTGAGAACCATTAATCGTTACCCCATGACCAAACAAGTTATGA TTCCAGTAGCGTGTGCTATAATACATAATTTTATCCACATGTACCGTAATGGGGACAGGCTATTGGACCAATACTCATAA GATGGCGTTCCGGTTGCAGACATTGATCTACCGAATGTTGATGAGGACATTAACGACAATACTAACCATGAGGGTCAACC ATTGGATTCTAATGCAGAAGTTGACATGAATGCTTTAAGGGATGCAAGGGCGCATACAATGTGGGCAGTGTACCAGCACC GTCGTGCACGCTGATGCCATCGTTCATTGTTGTCTTTTTAAACTTAAATATGTATTTTTTGCTGTCTTTTTGAACTTAAT TAAAATGAAAACTGAGCTTGTACTTGTTATTTTTATTATTTTTTTATTTTTGTAATTACAAGTAATTTATTACAATAAAA CATAATAAAGGCGGAAAAATAAAAAAATTGTAAAAGAATTGAATAAAATTGTAGGAGGAGAAAAAATGATATTCACTATT CACAACTCAAGTTTTATCACAAACAAACACAAACTCAAAAAATTCTTAACTCAAACCATAACTTAAGTATATACAACTAA ACGCAAACTCAAGTTACAACTTAAACTCAAGTTATAACTCAAATTCAACTCAAATTCAACTCAAAAACTTAACTCAAAAA TACTTGTAAAAGAACAAGCCC